ID: 930527763

View in Genome Browser
Species Human (GRCh38)
Location 2:52551596-52551618
Sequence ACATTCTTTTCTTCAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4627
Summary {0: 18, 1: 271, 2: 900, 3: 1544, 4: 1894}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527759_930527763 23 Left 930527759 2:52551550-52551572 CCTAATAGATATTTACAGAACAT 0: 181
1: 493
2: 759
3: 1653
4: 9589
Right 930527763 2:52551596-52551618 ACATTCTTTTCTTCAGCACATGG 0: 18
1: 271
2: 900
3: 1544
4: 1894
930527761_930527763 -1 Left 930527761 2:52551574-52551596 CCCTCTAATGGTTGCAGAATACA No data
Right 930527763 2:52551596-52551618 ACATTCTTTTCTTCAGCACATGG 0: 18
1: 271
2: 900
3: 1544
4: 1894
930527762_930527763 -2 Left 930527762 2:52551575-52551597 CCTCTAATGGTTGCAGAATACAC No data
Right 930527763 2:52551596-52551618 ACATTCTTTTCTTCAGCACATGG 0: 18
1: 271
2: 900
3: 1544
4: 1894

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527763 Original CRISPR ACATTCTTTTCTTCAGCACA TGG Intergenic
Too many off-targets to display for this crispr