ID: 930527764

View in Genome Browser
Species Human (GRCh38)
Location 2:52551626-52551648
Sequence TCAAGATTAAATCATATGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930527761_930527764 29 Left 930527761 2:52551574-52551596 CCCTCTAATGGTTGCAGAATACA No data
Right 930527764 2:52551626-52551648 TCAAGATTAAATCATATGTTAGG No data
930527762_930527764 28 Left 930527762 2:52551575-52551597 CCTCTAATGGTTGCAGAATACAC No data
Right 930527764 2:52551626-52551648 TCAAGATTAAATCATATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930527764 Original CRISPR TCAAGATTAAATCATATGTT AGG Intergenic
No off target data available for this crispr