ID: 930530710

View in Genome Browser
Species Human (GRCh38)
Location 2:52584726-52584748
Sequence TATAGGTATCCCAAACCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930530710_930530714 12 Left 930530710 2:52584726-52584748 CCAAGGGGTTTGGGATACCTATA No data
Right 930530714 2:52584761-52584783 CTGTCTTTTCAGATAAGCAGGGG No data
930530710_930530712 10 Left 930530710 2:52584726-52584748 CCAAGGGGTTTGGGATACCTATA No data
Right 930530712 2:52584759-52584781 AACTGTCTTTTCAGATAAGCAGG No data
930530710_930530713 11 Left 930530710 2:52584726-52584748 CCAAGGGGTTTGGGATACCTATA No data
Right 930530713 2:52584760-52584782 ACTGTCTTTTCAGATAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930530710 Original CRISPR TATAGGTATCCCAAACCCCT TGG (reversed) Intergenic
No off target data available for this crispr