ID: 930530711

View in Genome Browser
Species Human (GRCh38)
Location 2:52584743-52584765
Sequence GACAGTTGAAATCTTTGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930530711_930530716 17 Left 930530711 2:52584743-52584765 CCTATACAAAGATTTCAACTGTC No data
Right 930530716 2:52584783-52584805 GCAAATACTTATGCTTCTCAGGG No data
930530711_930530715 16 Left 930530711 2:52584743-52584765 CCTATACAAAGATTTCAACTGTC No data
Right 930530715 2:52584782-52584804 GGCAAATACTTATGCTTCTCAGG No data
930530711_930530714 -5 Left 930530711 2:52584743-52584765 CCTATACAAAGATTTCAACTGTC No data
Right 930530714 2:52584761-52584783 CTGTCTTTTCAGATAAGCAGGGG No data
930530711_930530712 -7 Left 930530711 2:52584743-52584765 CCTATACAAAGATTTCAACTGTC No data
Right 930530712 2:52584759-52584781 AACTGTCTTTTCAGATAAGCAGG No data
930530711_930530713 -6 Left 930530711 2:52584743-52584765 CCTATACAAAGATTTCAACTGTC No data
Right 930530713 2:52584760-52584782 ACTGTCTTTTCAGATAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930530711 Original CRISPR GACAGTTGAAATCTTTGTAT AGG (reversed) Intergenic
No off target data available for this crispr