ID: 930530714

View in Genome Browser
Species Human (GRCh38)
Location 2:52584761-52584783
Sequence CTGTCTTTTCAGATAAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930530710_930530714 12 Left 930530710 2:52584726-52584748 CCAAGGGGTTTGGGATACCTATA No data
Right 930530714 2:52584761-52584783 CTGTCTTTTCAGATAAGCAGGGG No data
930530711_930530714 -5 Left 930530711 2:52584743-52584765 CCTATACAAAGATTTCAACTGTC No data
Right 930530714 2:52584761-52584783 CTGTCTTTTCAGATAAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930530714 Original CRISPR CTGTCTTTTCAGATAAGCAG GGG Intergenic
No off target data available for this crispr