ID: 930538712

View in Genome Browser
Species Human (GRCh38)
Location 2:52677845-52677867
Sequence ACTTATTAGGACTCACTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930538709_930538712 -6 Left 930538709 2:52677828-52677850 CCTGTGCTTTGTTATTGACTTAT No data
Right 930538712 2:52677845-52677867 ACTTATTAGGACTCACTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930538712 Original CRISPR ACTTATTAGGACTCACTTTA GGG Intergenic
No off target data available for this crispr