ID: 930538912

View in Genome Browser
Species Human (GRCh38)
Location 2:52680405-52680427
Sequence GATTATTTAAGATCAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930538911_930538912 11 Left 930538911 2:52680371-52680393 CCAAAATAGTAAATAAATAATCA No data
Right 930538912 2:52680405-52680427 GATTATTTAAGATCAAACACTGG No data
930538909_930538912 30 Left 930538909 2:52680352-52680374 CCTTTGCCATGGAGAGGAACCAA No data
Right 930538912 2:52680405-52680427 GATTATTTAAGATCAAACACTGG No data
930538910_930538912 24 Left 930538910 2:52680358-52680380 CCATGGAGAGGAACCAAAATAGT No data
Right 930538912 2:52680405-52680427 GATTATTTAAGATCAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930538912 Original CRISPR GATTATTTAAGATCAAACAC TGG Intergenic
No off target data available for this crispr