ID: 930538927

View in Genome Browser
Species Human (GRCh38)
Location 2:52680494-52680516
Sequence ACACCCCCCACCAATCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930538927_930538929 -1 Left 930538927 2:52680494-52680516 CCTCAGGGATTGGTGGGGGGTGT No data
Right 930538929 2:52680516-52680538 TGGAAAGTCTCCCAATTGCAAGG No data
930538927_930538930 4 Left 930538927 2:52680494-52680516 CCTCAGGGATTGGTGGGGGGTGT No data
Right 930538930 2:52680521-52680543 AGTCTCCCAATTGCAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930538927 Original CRISPR ACACCCCCCACCAATCCCTG AGG (reversed) Intergenic
No off target data available for this crispr