ID: 930538930

View in Genome Browser
Species Human (GRCh38)
Location 2:52680521-52680543
Sequence AGTCTCCCAATTGCAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930538922_930538930 10 Left 930538922 2:52680488-52680510 CCTGTTCCTCAGGGATTGGTGGG No data
Right 930538930 2:52680521-52680543 AGTCTCCCAATTGCAAGGAAAGG No data
930538927_930538930 4 Left 930538927 2:52680494-52680516 CCTCAGGGATTGGTGGGGGGTGT No data
Right 930538930 2:52680521-52680543 AGTCTCCCAATTGCAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930538930 Original CRISPR AGTCTCCCAATTGCAAGGAA AGG Intergenic
No off target data available for this crispr