ID: 930539111

View in Genome Browser
Species Human (GRCh38)
Location 2:52681634-52681656
Sequence GCACCAATGTTAGCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930539111_930539115 4 Left 930539111 2:52681634-52681656 CCTGGACCTGCTAACATTGGTGC No data
Right 930539115 2:52681661-52681683 GTATGCTAACCTGGAGCCCAAGG No data
930539111_930539116 9 Left 930539111 2:52681634-52681656 CCTGGACCTGCTAACATTGGTGC No data
Right 930539116 2:52681666-52681688 CTAACCTGGAGCCCAAGGACAGG No data
930539111_930539113 -5 Left 930539111 2:52681634-52681656 CCTGGACCTGCTAACATTGGTGC No data
Right 930539113 2:52681652-52681674 GGTGCCAGTGTATGCTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930539111 Original CRISPR GCACCAATGTTAGCAGGTCC AGG (reversed) Intergenic
No off target data available for this crispr