ID: 930539113

View in Genome Browser
Species Human (GRCh38)
Location 2:52681652-52681674
Sequence GGTGCCAGTGTATGCTAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930539107_930539113 11 Left 930539107 2:52681618-52681640 CCCAATAATTGGCCTGCCTGGAC No data
Right 930539113 2:52681652-52681674 GGTGCCAGTGTATGCTAACCTGG No data
930539109_930539113 -1 Left 930539109 2:52681630-52681652 CCTGCCTGGACCTGCTAACATTG No data
Right 930539113 2:52681652-52681674 GGTGCCAGTGTATGCTAACCTGG No data
930539111_930539113 -5 Left 930539111 2:52681634-52681656 CCTGGACCTGCTAACATTGGTGC No data
Right 930539113 2:52681652-52681674 GGTGCCAGTGTATGCTAACCTGG No data
930539108_930539113 10 Left 930539108 2:52681619-52681641 CCAATAATTGGCCTGCCTGGACC No data
Right 930539113 2:52681652-52681674 GGTGCCAGTGTATGCTAACCTGG No data
930539105_930539113 19 Left 930539105 2:52681610-52681632 CCTGGAGGCCCAATAATTGGCCT No data
Right 930539113 2:52681652-52681674 GGTGCCAGTGTATGCTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930539113 Original CRISPR GGTGCCAGTGTATGCTAACC TGG Intergenic
No off target data available for this crispr