ID: 930539115

View in Genome Browser
Species Human (GRCh38)
Location 2:52681661-52681683
Sequence GTATGCTAACCTGGAGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930539112_930539115 -2 Left 930539112 2:52681640-52681662 CCTGCTAACATTGGTGCCAGTGT No data
Right 930539115 2:52681661-52681683 GTATGCTAACCTGGAGCCCAAGG No data
930539107_930539115 20 Left 930539107 2:52681618-52681640 CCCAATAATTGGCCTGCCTGGAC No data
Right 930539115 2:52681661-52681683 GTATGCTAACCTGGAGCCCAAGG No data
930539111_930539115 4 Left 930539111 2:52681634-52681656 CCTGGACCTGCTAACATTGGTGC No data
Right 930539115 2:52681661-52681683 GTATGCTAACCTGGAGCCCAAGG No data
930539109_930539115 8 Left 930539109 2:52681630-52681652 CCTGCCTGGACCTGCTAACATTG No data
Right 930539115 2:52681661-52681683 GTATGCTAACCTGGAGCCCAAGG No data
930539108_930539115 19 Left 930539108 2:52681619-52681641 CCAATAATTGGCCTGCCTGGACC No data
Right 930539115 2:52681661-52681683 GTATGCTAACCTGGAGCCCAAGG No data
930539105_930539115 28 Left 930539105 2:52681610-52681632 CCTGGAGGCCCAATAATTGGCCT No data
Right 930539115 2:52681661-52681683 GTATGCTAACCTGGAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930539115 Original CRISPR GTATGCTAACCTGGAGCCCA AGG Intergenic
No off target data available for this crispr