ID: 930542646

View in Genome Browser
Species Human (GRCh38)
Location 2:52726322-52726344
Sequence GGAGCCATACTGCTTCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930542646_930542649 0 Left 930542646 2:52726322-52726344 CCCTCAAGAAGCAGTATGGCTCC No data
Right 930542649 2:52726345-52726367 AATATTCAGATTTCACTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930542646 Original CRISPR GGAGCCATACTGCTTCTTGA GGG (reversed) Intergenic
No off target data available for this crispr