ID: 930561015

View in Genome Browser
Species Human (GRCh38)
Location 2:52959908-52959930
Sequence CAGGCTCAGGATGCGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930561008_930561015 15 Left 930561008 2:52959870-52959892 CCTATTTGGATCTAATAAAAAAA No data
Right 930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930561015 Original CRISPR CAGGCTCAGGATGCGGTGGG TGG Intergenic
No off target data available for this crispr