ID: 930566246

View in Genome Browser
Species Human (GRCh38)
Location 2:53024053-53024075
Sequence CTGTCCTAATAACTGGAATC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930566242_930566246 0 Left 930566242 2:53024030-53024052 CCGTGATGAACCAGTCAGGATCT No data
Right 930566246 2:53024053-53024075 CTGTCCTAATAACTGGAATCGGG No data
930566243_930566246 -10 Left 930566243 2:53024040-53024062 CCAGTCAGGATCTCTGTCCTAAT No data
Right 930566246 2:53024053-53024075 CTGTCCTAATAACTGGAATCGGG No data
930566241_930566246 1 Left 930566241 2:53024029-53024051 CCCGTGATGAACCAGTCAGGATC No data
Right 930566246 2:53024053-53024075 CTGTCCTAATAACTGGAATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930566246 Original CRISPR CTGTCCTAATAACTGGAATC GGG Intergenic
No off target data available for this crispr