ID: 930573273

View in Genome Browser
Species Human (GRCh38)
Location 2:53113309-53113331
Sequence CATACATTCCTCTTTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930573273_930573277 0 Left 930573273 2:53113309-53113331 CCTCAGCAAAAGAGGAATGTATG No data
Right 930573277 2:53113332-53113354 TGCTGTGGTGGGTTTTCCTTAGG No data
930573273_930573280 21 Left 930573273 2:53113309-53113331 CCTCAGCAAAAGAGGAATGTATG No data
Right 930573280 2:53113353-53113375 GGAACATTTATGGACCTTAAAGG No data
930573273_930573278 11 Left 930573273 2:53113309-53113331 CCTCAGCAAAAGAGGAATGTATG No data
Right 930573278 2:53113343-53113365 GTTTTCCTTAGGAACATTTATGG No data
930573273_930573282 23 Left 930573273 2:53113309-53113331 CCTCAGCAAAAGAGGAATGTATG No data
Right 930573282 2:53113355-53113377 AACATTTATGGACCTTAAAGGGG No data
930573273_930573281 22 Left 930573273 2:53113309-53113331 CCTCAGCAAAAGAGGAATGTATG No data
Right 930573281 2:53113354-53113376 GAACATTTATGGACCTTAAAGGG No data
930573273_930573283 24 Left 930573273 2:53113309-53113331 CCTCAGCAAAAGAGGAATGTATG No data
Right 930573283 2:53113356-53113378 ACATTTATGGACCTTAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930573273 Original CRISPR CATACATTCCTCTTTTGCTG AGG (reversed) Intergenic