ID: 930573280

View in Genome Browser
Species Human (GRCh38)
Location 2:53113353-53113375
Sequence GGAACATTTATGGACCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930573273_930573280 21 Left 930573273 2:53113309-53113331 CCTCAGCAAAAGAGGAATGTATG No data
Right 930573280 2:53113353-53113375 GGAACATTTATGGACCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930573280 Original CRISPR GGAACATTTATGGACCTTAA AGG Intergenic
No off target data available for this crispr