ID: 930573280 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:53113353-53113375 |
Sequence | GGAACATTTATGGACCTTAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
930573273_930573280 | 21 | Left | 930573273 | 2:53113309-53113331 | CCTCAGCAAAAGAGGAATGTATG | No data | ||
Right | 930573280 | 2:53113353-53113375 | GGAACATTTATGGACCTTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
930573280 | Original CRISPR | GGAACATTTATGGACCTTAA AGG | Intergenic | ||