ID: 930573281

View in Genome Browser
Species Human (GRCh38)
Location 2:53113354-53113376
Sequence GAACATTTATGGACCTTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930573273_930573281 22 Left 930573273 2:53113309-53113331 CCTCAGCAAAAGAGGAATGTATG No data
Right 930573281 2:53113354-53113376 GAACATTTATGGACCTTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930573281 Original CRISPR GAACATTTATGGACCTTAAA GGG Intergenic