ID: 930573282

View in Genome Browser
Species Human (GRCh38)
Location 2:53113355-53113377
Sequence AACATTTATGGACCTTAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930573273_930573282 23 Left 930573273 2:53113309-53113331 CCTCAGCAAAAGAGGAATGTATG No data
Right 930573282 2:53113355-53113377 AACATTTATGGACCTTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930573282 Original CRISPR AACATTTATGGACCTTAAAG GGG Intergenic
No off target data available for this crispr