ID: 930576828

View in Genome Browser
Species Human (GRCh38)
Location 2:53160830-53160852
Sequence GAAAATGCAAAGTTGCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930576828_930576832 22 Left 930576828 2:53160830-53160852 CCCTTCTGCAACTTTGCATTTTC No data
Right 930576832 2:53160875-53160897 ATTTATATGTGCTCAGTCAAGGG No data
930576828_930576831 21 Left 930576828 2:53160830-53160852 CCCTTCTGCAACTTTGCATTTTC No data
Right 930576831 2:53160874-53160896 TATTTATATGTGCTCAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930576828 Original CRISPR GAAAATGCAAAGTTGCAGAA GGG (reversed) Intergenic
No off target data available for this crispr