ID: 930580347

View in Genome Browser
Species Human (GRCh38)
Location 2:53203677-53203699
Sequence ACTATTGCATAAGAGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930580347_930580349 9 Left 930580347 2:53203677-53203699 CCTCAGAACTCTTATGCAATAGT No data
Right 930580349 2:53203709-53203731 AGGAGCTTATCCAATTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930580347 Original CRISPR ACTATTGCATAAGAGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr