ID: 930582099

View in Genome Browser
Species Human (GRCh38)
Location 2:53224130-53224152
Sequence ACATGCATAGGGCCATGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930582095_930582099 22 Left 930582095 2:53224085-53224107 CCTGAAGGCAGGAGTGCTTCATT No data
Right 930582099 2:53224130-53224152 ACATGCATAGGGCCATGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930582099 Original CRISPR ACATGCATAGGGCCATGCTT TGG Intergenic
No off target data available for this crispr