ID: 930585763

View in Genome Browser
Species Human (GRCh38)
Location 2:53264958-53264980
Sequence TTCTATACTCAGATTTAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930585762_930585763 19 Left 930585762 2:53264916-53264938 CCTAAATATTGCATGGCACATAG No data
Right 930585763 2:53264958-53264980 TTCTATACTCAGATTTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930585763 Original CRISPR TTCTATACTCAGATTTAACT AGG Intergenic
No off target data available for this crispr