ID: 930590572

View in Genome Browser
Species Human (GRCh38)
Location 2:53321973-53321995
Sequence CAGAGTAAAGAGAAGAAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930590572_930590578 17 Left 930590572 2:53321973-53321995 CCACACTTCTTCTCTTTACTCTG No data
Right 930590578 2:53322013-53322035 GGTAAATCATGTAGTCCCATGGG No data
930590572_930590573 -4 Left 930590572 2:53321973-53321995 CCACACTTCTTCTCTTTACTCTG No data
Right 930590573 2:53321992-53322014 TCTGTCCTCACTCAGTCCCTAGG No data
930590572_930590577 16 Left 930590572 2:53321973-53321995 CCACACTTCTTCTCTTTACTCTG No data
Right 930590577 2:53322012-53322034 AGGTAAATCATGTAGTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930590572 Original CRISPR CAGAGTAAAGAGAAGAAGTG TGG (reversed) Intergenic
No off target data available for this crispr