ID: 930590860

View in Genome Browser
Species Human (GRCh38)
Location 2:53324163-53324185
Sequence AGAGCTGCTGCCCCTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930590860_930590865 4 Left 930590860 2:53324163-53324185 CCTCCCAAAGGGGCAGCAGCTCT No data
Right 930590865 2:53324190-53324212 TACAAGAGGAGGAGTGCTTATGG No data
930590860_930590863 -10 Left 930590860 2:53324163-53324185 CCTCCCAAAGGGGCAGCAGCTCT No data
Right 930590863 2:53324176-53324198 CAGCAGCTCTTAATTACAAGAGG No data
930590860_930590864 -7 Left 930590860 2:53324163-53324185 CCTCCCAAAGGGGCAGCAGCTCT No data
Right 930590864 2:53324179-53324201 CAGCTCTTAATTACAAGAGGAGG No data
930590860_930590866 10 Left 930590860 2:53324163-53324185 CCTCCCAAAGGGGCAGCAGCTCT No data
Right 930590866 2:53324196-53324218 AGGAGGAGTGCTTATGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930590860 Original CRISPR AGAGCTGCTGCCCCTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr