ID: 930595676

View in Genome Browser
Species Human (GRCh38)
Location 2:53385376-53385398
Sequence CTGTTCAATAGCAGCAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930595676_930595677 26 Left 930595676 2:53385376-53385398 CCTAGGTTGCTGCTATTGAACAG No data
Right 930595677 2:53385425-53385447 CAATTCCAGTGATTATTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930595676 Original CRISPR CTGTTCAATAGCAGCAACCT AGG (reversed) Intergenic
No off target data available for this crispr