ID: 930599023

View in Genome Browser
Species Human (GRCh38)
Location 2:53423167-53423189
Sequence CTCAGTACTCTGAGAGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930599021_930599023 2 Left 930599021 2:53423142-53423164 CCTCATGATTGCAGCAGTGTTCT No data
Right 930599023 2:53423167-53423189 CTCAGTACTCTGAGAGTGTAGGG No data
930599019_930599023 13 Left 930599019 2:53423131-53423153 CCTCTCCATTTCCTCATGATTGC No data
Right 930599023 2:53423167-53423189 CTCAGTACTCTGAGAGTGTAGGG No data
930599018_930599023 24 Left 930599018 2:53423120-53423142 CCACATTAGCTCCTCTCCATTTC No data
Right 930599023 2:53423167-53423189 CTCAGTACTCTGAGAGTGTAGGG No data
930599020_930599023 8 Left 930599020 2:53423136-53423158 CCATTTCCTCATGATTGCAGCAG No data
Right 930599023 2:53423167-53423189 CTCAGTACTCTGAGAGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930599023 Original CRISPR CTCAGTACTCTGAGAGTGTA GGG Intergenic
No off target data available for this crispr