ID: 930600403

View in Genome Browser
Species Human (GRCh38)
Location 2:53436270-53436292
Sequence TGGGATAAGAACCACCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930600399_930600403 11 Left 930600399 2:53436236-53436258 CCTCAAATGATAATGAATTAATT No data
Right 930600403 2:53436270-53436292 TGGGATAAGAACCACCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930600403 Original CRISPR TGGGATAAGAACCACCAGCC AGG Intergenic
No off target data available for this crispr