ID: 930600448

View in Genome Browser
Species Human (GRCh38)
Location 2:53436742-53436764
Sequence ATACATATTAAAATGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930600448_930600450 -8 Left 930600448 2:53436742-53436764 CCATCCTTCATTTTAATATGTAT No data
Right 930600450 2:53436757-53436779 ATATGTATGTGACTGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930600448 Original CRISPR ATACATATTAAAATGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr