ID: 930600450

View in Genome Browser
Species Human (GRCh38)
Location 2:53436757-53436779
Sequence ATATGTATGTGACTGTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930600446_930600450 3 Left 930600446 2:53436731-53436753 CCCAACTGATTCCATCCTTCATT No data
Right 930600450 2:53436757-53436779 ATATGTATGTGACTGTCTCTAGG No data
930600447_930600450 2 Left 930600447 2:53436732-53436754 CCAACTGATTCCATCCTTCATTT No data
Right 930600450 2:53436757-53436779 ATATGTATGTGACTGTCTCTAGG No data
930600448_930600450 -8 Left 930600448 2:53436742-53436764 CCATCCTTCATTTTAATATGTAT No data
Right 930600450 2:53436757-53436779 ATATGTATGTGACTGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930600450 Original CRISPR ATATGTATGTGACTGTCTCT AGG Intergenic
No off target data available for this crispr