ID: 930605948

View in Genome Browser
Species Human (GRCh38)
Location 2:53493179-53493201
Sequence CTGTAAACTCACATGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930605948_930605951 -5 Left 930605948 2:53493179-53493201 CCTTCTCCCATGTGAGTTTACAG No data
Right 930605951 2:53493197-53493219 TACAGCAAAAACCAGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930605948 Original CRISPR CTGTAAACTCACATGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr