ID: 930606297

View in Genome Browser
Species Human (GRCh38)
Location 2:53496834-53496856
Sequence GAGTCGCACGTTTGTATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606297_930606303 25 Left 930606297 2:53496834-53496856 CCAGTCATACAAACGTGCGACTC No data
Right 930606303 2:53496882-53496904 ATTTCTCCTCAGTGGTGTGTTGG No data
930606297_930606301 17 Left 930606297 2:53496834-53496856 CCAGTCATACAAACGTGCGACTC No data
Right 930606301 2:53496874-53496896 AATTGCCGATTTCTCCTCAGTGG No data
930606297_930606304 28 Left 930606297 2:53496834-53496856 CCAGTCATACAAACGTGCGACTC No data
Right 930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG No data
930606297_930606298 -9 Left 930606297 2:53496834-53496856 CCAGTCATACAAACGTGCGACTC No data
Right 930606298 2:53496848-53496870 GTGCGACTCCTGTGTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930606297 Original CRISPR GAGTCGCACGTTTGTATGAC TGG (reversed) Intergenic
No off target data available for this crispr