ID: 930606299

View in Genome Browser
Species Human (GRCh38)
Location 2:53496856-53496878
Sequence CAATTAGGCCAGAAACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606299_930606308 30 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606308 2:53496909-53496931 ATGCATAGACTGGCAGCTTTGGG No data
930606299_930606304 6 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG No data
930606299_930606306 20 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606306 2:53496899-53496921 TGTTGGTGGAATGCATAGACTGG No data
930606299_930606307 29 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606307 2:53496908-53496930 AATGCATAGACTGGCAGCTTTGG No data
930606299_930606301 -5 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606301 2:53496874-53496896 AATTGCCGATTTCTCCTCAGTGG No data
930606299_930606303 3 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606303 2:53496882-53496904 ATTTCTCCTCAGTGGTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930606299 Original CRISPR CAATTAGGCCAGAAACACAC AGG (reversed) Intergenic
No off target data available for this crispr