ID: 930606300

View in Genome Browser
Species Human (GRCh38)
Location 2:53496871-53496893
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606300_930606307 14 Left 930606300 2:53496871-53496893 CCTAATTGCCGATTTCTCCTCAG No data
Right 930606307 2:53496908-53496930 AATGCATAGACTGGCAGCTTTGG No data
930606300_930606309 18 Left 930606300 2:53496871-53496893 CCTAATTGCCGATTTCTCCTCAG No data
Right 930606309 2:53496912-53496934 CATAGACTGGCAGCTTTGGGAGG No data
930606300_930606304 -9 Left 930606300 2:53496871-53496893 CCTAATTGCCGATTTCTCCTCAG No data
Right 930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG No data
930606300_930606308 15 Left 930606300 2:53496871-53496893 CCTAATTGCCGATTTCTCCTCAG No data
Right 930606308 2:53496909-53496931 ATGCATAGACTGGCAGCTTTGGG No data
930606300_930606306 5 Left 930606300 2:53496871-53496893 CCTAATTGCCGATTTCTCCTCAG No data
Right 930606306 2:53496899-53496921 TGTTGGTGGAATGCATAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930606300 Original CRISPR CTGAGGAGAAATCGGCAATT AGG (reversed) Intergenic