ID: 930606301

View in Genome Browser
Species Human (GRCh38)
Location 2:53496874-53496896
Sequence AATTGCCGATTTCTCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606296_930606301 20 Left 930606296 2:53496831-53496853 CCACCAGTCATACAAACGTGCGA No data
Right 930606301 2:53496874-53496896 AATTGCCGATTTCTCCTCAGTGG No data
930606299_930606301 -5 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606301 2:53496874-53496896 AATTGCCGATTTCTCCTCAGTGG No data
930606297_930606301 17 Left 930606297 2:53496834-53496856 CCAGTCATACAAACGTGCGACTC No data
Right 930606301 2:53496874-53496896 AATTGCCGATTTCTCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930606301 Original CRISPR AATTGCCGATTTCTCCTCAG TGG Intergenic