ID: 930606302

View in Genome Browser
Species Human (GRCh38)
Location 2:53496879-53496901
Sequence ACACACCACTGAGGAGAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606302_930606309 10 Left 930606302 2:53496879-53496901 CCGATTTCTCCTCAGTGGTGTGT No data
Right 930606309 2:53496912-53496934 CATAGACTGGCAGCTTTGGGAGG No data
930606302_930606308 7 Left 930606302 2:53496879-53496901 CCGATTTCTCCTCAGTGGTGTGT No data
Right 930606308 2:53496909-53496931 ATGCATAGACTGGCAGCTTTGGG No data
930606302_930606306 -3 Left 930606302 2:53496879-53496901 CCGATTTCTCCTCAGTGGTGTGT No data
Right 930606306 2:53496899-53496921 TGTTGGTGGAATGCATAGACTGG No data
930606302_930606307 6 Left 930606302 2:53496879-53496901 CCGATTTCTCCTCAGTGGTGTGT No data
Right 930606307 2:53496908-53496930 AATGCATAGACTGGCAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930606302 Original CRISPR ACACACCACTGAGGAGAAAT CGG (reversed) Intergenic