ID: 930606304

View in Genome Browser
Species Human (GRCh38)
Location 2:53496885-53496907
Sequence TCTCCTCAGTGGTGTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606300_930606304 -9 Left 930606300 2:53496871-53496893 CCTAATTGCCGATTTCTCCTCAG No data
Right 930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG No data
930606297_930606304 28 Left 930606297 2:53496834-53496856 CCAGTCATACAAACGTGCGACTC No data
Right 930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG No data
930606299_930606304 6 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606304 2:53496885-53496907 TCTCCTCAGTGGTGTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930606304 Original CRISPR TCTCCTCAGTGGTGTGTTGG TGG Intergenic
No off target data available for this crispr