ID: 930606305

View in Genome Browser
Species Human (GRCh38)
Location 2:53496888-53496910
Sequence ATTCCACCAACACACCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606305_930606309 1 Left 930606305 2:53496888-53496910 CCTCAGTGGTGTGTTGGTGGAAT No data
Right 930606309 2:53496912-53496934 CATAGACTGGCAGCTTTGGGAGG No data
930606305_930606308 -2 Left 930606305 2:53496888-53496910 CCTCAGTGGTGTGTTGGTGGAAT No data
Right 930606308 2:53496909-53496931 ATGCATAGACTGGCAGCTTTGGG No data
930606305_930606307 -3 Left 930606305 2:53496888-53496910 CCTCAGTGGTGTGTTGGTGGAAT No data
Right 930606307 2:53496908-53496930 AATGCATAGACTGGCAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930606305 Original CRISPR ATTCCACCAACACACCACTG AGG (reversed) Intergenic