ID: 930606306

View in Genome Browser
Species Human (GRCh38)
Location 2:53496899-53496921
Sequence TGTTGGTGGAATGCATAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606302_930606306 -3 Left 930606302 2:53496879-53496901 CCGATTTCTCCTCAGTGGTGTGT No data
Right 930606306 2:53496899-53496921 TGTTGGTGGAATGCATAGACTGG No data
930606300_930606306 5 Left 930606300 2:53496871-53496893 CCTAATTGCCGATTTCTCCTCAG No data
Right 930606306 2:53496899-53496921 TGTTGGTGGAATGCATAGACTGG No data
930606299_930606306 20 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606306 2:53496899-53496921 TGTTGGTGGAATGCATAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930606306 Original CRISPR TGTTGGTGGAATGCATAGAC TGG Intergenic