ID: 930606308

View in Genome Browser
Species Human (GRCh38)
Location 2:53496909-53496931
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606300_930606308 15 Left 930606300 2:53496871-53496893 CCTAATTGCCGATTTCTCCTCAG No data
Right 930606308 2:53496909-53496931 ATGCATAGACTGGCAGCTTTGGG No data
930606299_930606308 30 Left 930606299 2:53496856-53496878 CCTGTGTGTTTCTGGCCTAATTG No data
Right 930606308 2:53496909-53496931 ATGCATAGACTGGCAGCTTTGGG No data
930606302_930606308 7 Left 930606302 2:53496879-53496901 CCGATTTCTCCTCAGTGGTGTGT No data
Right 930606308 2:53496909-53496931 ATGCATAGACTGGCAGCTTTGGG No data
930606305_930606308 -2 Left 930606305 2:53496888-53496910 CCTCAGTGGTGTGTTGGTGGAAT No data
Right 930606308 2:53496909-53496931 ATGCATAGACTGGCAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type