ID: 930606309

View in Genome Browser
Species Human (GRCh38)
Location 2:53496912-53496934
Sequence CATAGACTGGCAGCTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930606305_930606309 1 Left 930606305 2:53496888-53496910 CCTCAGTGGTGTGTTGGTGGAAT No data
Right 930606309 2:53496912-53496934 CATAGACTGGCAGCTTTGGGAGG No data
930606302_930606309 10 Left 930606302 2:53496879-53496901 CCGATTTCTCCTCAGTGGTGTGT No data
Right 930606309 2:53496912-53496934 CATAGACTGGCAGCTTTGGGAGG No data
930606300_930606309 18 Left 930606300 2:53496871-53496893 CCTAATTGCCGATTTCTCCTCAG No data
Right 930606309 2:53496912-53496934 CATAGACTGGCAGCTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930606309 Original CRISPR CATAGACTGGCAGCTTTGGG AGG Intergenic