ID: 930607856

View in Genome Browser
Species Human (GRCh38)
Location 2:53510896-53510918
Sequence CTCGTTTTGTATTATGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930607856_930607860 29 Left 930607856 2:53510896-53510918 CCAAACACATAATACAAAACGAG No data
Right 930607860 2:53510948-53510970 GTTCAGCCTCCGTGCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930607856 Original CRISPR CTCGTTTTGTATTATGTGTT TGG (reversed) Intergenic
No off target data available for this crispr