ID: 930607860

View in Genome Browser
Species Human (GRCh38)
Location 2:53510948-53510970
Sequence GTTCAGCCTCCGTGCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930607858_930607860 5 Left 930607858 2:53510920-53510942 CCCAGAGAGAAGAGCTGAGAGAA No data
Right 930607860 2:53510948-53510970 GTTCAGCCTCCGTGCAGCAGAGG No data
930607859_930607860 4 Left 930607859 2:53510921-53510943 CCAGAGAGAAGAGCTGAGAGAAA No data
Right 930607860 2:53510948-53510970 GTTCAGCCTCCGTGCAGCAGAGG No data
930607856_930607860 29 Left 930607856 2:53510896-53510918 CCAAACACATAATACAAAACGAG No data
Right 930607860 2:53510948-53510970 GTTCAGCCTCCGTGCAGCAGAGG No data
930607857_930607860 6 Left 930607857 2:53510919-53510941 CCCCAGAGAGAAGAGCTGAGAGA No data
Right 930607860 2:53510948-53510970 GTTCAGCCTCCGTGCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930607860 Original CRISPR GTTCAGCCTCCGTGCAGCAG AGG Intergenic
No off target data available for this crispr