ID: 930608324

View in Genome Browser
Species Human (GRCh38)
Location 2:53515074-53515096
Sequence TACTTGGTTGTTAGGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930608324_930608327 3 Left 930608324 2:53515074-53515096 CCTTCATTCCTAACAACCAAGTA No data
Right 930608327 2:53515100-53515122 TGCACTCCGTGAACACCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930608324 Original CRISPR TACTTGGTTGTTAGGAATGA AGG (reversed) Intergenic
No off target data available for this crispr