ID: 930608327

View in Genome Browser
Species Human (GRCh38)
Location 2:53515100-53515122
Sequence TGCACTCCGTGAACACCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930608322_930608327 13 Left 930608322 2:53515064-53515086 CCATGGGCACCCTTCATTCCTAA No data
Right 930608327 2:53515100-53515122 TGCACTCCGTGAACACCACTAGG No data
930608325_930608327 -5 Left 930608325 2:53515082-53515104 CCTAACAACCAAGTACGCTGCAC No data
Right 930608327 2:53515100-53515122 TGCACTCCGTGAACACCACTAGG No data
930608323_930608327 4 Left 930608323 2:53515073-53515095 CCCTTCATTCCTAACAACCAAGT No data
Right 930608327 2:53515100-53515122 TGCACTCCGTGAACACCACTAGG No data
930608324_930608327 3 Left 930608324 2:53515074-53515096 CCTTCATTCCTAACAACCAAGTA No data
Right 930608327 2:53515100-53515122 TGCACTCCGTGAACACCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930608327 Original CRISPR TGCACTCCGTGAACACCACT AGG Intergenic
No off target data available for this crispr