ID: 930609791

View in Genome Browser
Species Human (GRCh38)
Location 2:53528981-53529003
Sequence GTGCAGACCCAAAATTCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930609788_930609791 9 Left 930609788 2:53528949-53528971 CCTCAGGTCTAAAGATCAAGCAG No data
Right 930609791 2:53528981-53529003 GTGCAGACCCAAAATTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930609791 Original CRISPR GTGCAGACCCAAAATTCTAG GGG Intergenic
No off target data available for this crispr