ID: 930611328

View in Genome Browser
Species Human (GRCh38)
Location 2:53547330-53547352
Sequence GCTAGGACTTGAGGCAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930611328_930611332 0 Left 930611328 2:53547330-53547352 CCCTCACTGCCTCAAGTCCTAGC 0: 1
1: 0
2: 2
3: 15
4: 168
Right 930611332 2:53547353-53547375 TCAAATGTCCTTGTTTCAATAGG 0: 1
1: 0
2: 1
3: 14
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930611328 Original CRISPR GCTAGGACTTGAGGCAGTGA GGG (reversed) Intronic
900129146 1:1080286-1080308 GCCAGGACCTGTGGCAGCGAGGG - Intergenic
900280354 1:1863245-1863267 GCTAGAAATGGAAGCAGTGAGGG + Intronic
902098508 1:13966113-13966135 GGTAGGGCTTGAGGAAGGGAAGG - Intergenic
902140852 1:14353121-14353143 GCTAGGACTTTGGCCAATGATGG - Intergenic
902306082 1:15540417-15540439 GCTAGGACTAGAGGCACACACGG + Intronic
904256257 1:29256927-29256949 GCTAGGTCTTGAGGATGTGGTGG + Intronic
905655799 1:39685183-39685205 GCTAGGCCCTGTGCCAGTGATGG + Intronic
905867561 1:41384430-41384452 TCTTGGACTTGAGTCAGGGAAGG + Intergenic
907498534 1:54861445-54861467 GCTAGGAAGAGAGGCGGTGATGG - Intronic
909055148 1:70811983-70812005 GAAAGGACTTGAAGCAGTGAAGG + Intergenic
910905096 1:92167279-92167301 CATAGGATTTAAGGCAGTGATGG + Intronic
911250745 1:95573659-95573681 TATAGGTCTTGAGGCAGTGAAGG + Intergenic
913664149 1:121032042-121032064 CCTAGGAGTTCAGACAGTGAGGG + Intergenic
914015541 1:143815321-143815343 CCTAGGAGTTCAGACAGTGAGGG + Intergenic
914162242 1:145145687-145145709 CCTAGGAGTTCAGACAGTGAGGG - Intergenic
914654160 1:149723862-149723884 CCTAGGAGTTCAGACAGTGAGGG + Intergenic
914686805 1:149987316-149987338 GAGAGGAGTTGAAGCAGTGAGGG - Intronic
918119534 1:181526057-181526079 GCTAGGTCAGGAGGCAGGGAGGG + Intronic
918251167 1:182704712-182704734 GCCAGGAGTGGGGGCAGTGAGGG - Intergenic
918311699 1:183289778-183289800 GATAGGACTTCAGAAAGTGAGGG - Intronic
922652769 1:227355466-227355488 GCCAGCTCTTGAGGCAATGAAGG + Intergenic
922822528 1:228494118-228494140 GCTAGGACTTCAGGAAGGGACGG - Exonic
1063611033 10:7562130-7562152 GCTAGGACGGGAGGCAGAGCCGG - Exonic
1064745221 10:18472044-18472066 GATAGGAATGGGGGCAGTGAAGG - Intronic
1067350558 10:45472093-45472115 CCTAGGCCTAGAGGAAGTGAGGG - Intronic
1067789312 10:49275833-49275855 GGTAGCATTTGAGGCAGTGTTGG - Intergenic
1069898740 10:71695122-71695144 GCCAAGACTGGAGGCAGGGATGG + Intronic
1069960978 10:72079318-72079340 CCTAGGACTTGAAGCAGAGTTGG - Intronic
1071079332 10:81791836-81791858 GCTATGACTACAGTCAGTGATGG - Intergenic
1074172174 10:110952515-110952537 GCTAGGGGTTGGGGGAGTGAGGG - Intronic
1077403282 11:2369363-2369385 GCTGGGAGTGGAGGCAGAGATGG - Intergenic
1077999758 11:7484251-7484273 GTTAGGACTTGAGGCATTTGTGG + Intergenic
1078432214 11:11296946-11296968 GCTGGGACTGCAGGCACTGAAGG - Intronic
1080303948 11:30816790-30816812 GGTTGCCCTTGAGGCAGTGAAGG - Intergenic
1083638486 11:64132968-64132990 GCCAGGACTCGGGGCAGTGGGGG - Intronic
1089001693 11:115057475-115057497 GCAGAGACTTGAGGCAGGGAAGG - Intergenic
1091704616 12:2685473-2685495 GTTCTGACTTGGGGCAGTGAAGG - Intronic
1091711186 12:2741810-2741832 GTTCTGACTTGGGGCAGTGAAGG - Intergenic
1092178264 12:6426125-6426147 GCTAGGACTTGATGCAGAAGAGG - Intergenic
1093928771 12:24934423-24934445 TCAAGGTCTTGAGGCTGTGAGGG - Intronic
1094492154 12:30967443-30967465 TCTGGGGCTTGAGGCAGAGAGGG + Intronic
1096873892 12:54612313-54612335 GGTAGGAAATGAGGCTGTGAAGG - Intergenic
1098340714 12:69448148-69448170 CCTAGGAGCTGAGGCTGTGATGG + Intergenic
1099829427 12:87821739-87821761 ACCAGAAATTGAGGCAGTGAAGG + Intergenic
1104793620 12:131500244-131500266 GCCAGGATGTGAGCCAGTGAGGG + Intergenic
1106518899 13:30479450-30479472 GCTAGAATTTGAGCCAGTGTGGG - Intronic
1107720976 13:43247500-43247522 GGTAGTACTTCAGGCTGTGAAGG + Intronic
1116178377 14:41503768-41503790 AGTAGGACATGAGGCTGTGAAGG + Intergenic
1116222897 14:42111575-42111597 GCCTGGACTTGAAGCAGAGAGGG + Intergenic
1117299636 14:54412030-54412052 GCTAATAAGTGAGGCAGTGATGG - Intronic
1117834677 14:59791385-59791407 GCTGGGACTTTAAGCAGTTACGG + Intronic
1117895818 14:60485716-60485738 GCCAGGACAGGAGGCTGTGAGGG - Intronic
1121079437 14:91095852-91095874 GCTTTGGATTGAGGCAGTGATGG - Intronic
1122265141 14:100543110-100543132 GCCAGGACCTGAGGGAGTGAAGG - Intronic
1122600186 14:102917533-102917555 GCCAGGACTTGGGGCAGCAATGG - Intergenic
1122655120 14:103253512-103253534 ACTAGGACTAGAGGCAGAGGTGG - Intergenic
1124129909 15:26974244-26974266 GCCAGGACAGGTGGCAGTGAGGG - Intronic
1125783303 15:42291039-42291061 GATGGGTCTGGAGGCAGTGAAGG - Intronic
1128112436 15:65085236-65085258 GCGGGGACTTGAGTCAGTGAAGG - Intergenic
1130776090 15:86984881-86984903 GCCAGGAGTGGAGGCAGGGATGG - Intronic
1131387294 15:92018147-92018169 GCCAGGCCTTGGGGCGGTGACGG + Intronic
1132464287 16:70672-70694 CCTGGGACCTTAGGCAGTGATGG - Intronic
1135625710 16:23993082-23993104 GCTAGGACTTGAAGGGGTGGTGG - Intronic
1137406728 16:48194976-48194998 GCTGGGATTTGAAGCAGTTAAGG + Intronic
1138288698 16:55829497-55829519 GCTGGGACTTGCGGCAGGGGAGG + Intronic
1138620922 16:58210719-58210741 GCTGAGACTTGAAGAAGTGAAGG + Intergenic
1140023584 16:71262759-71262781 CCCAGGACCTGAGGCAGTGCCGG + Intergenic
1142174692 16:88639702-88639724 GATAGGACCTGAGGCAGCGAGGG - Intronic
1145007370 17:19345160-19345182 GCAAGGACCTGAGGCAAGGAAGG + Intronic
1145781808 17:27568463-27568485 GCTCGGAATTCAGCCAGTGAGGG - Intronic
1145934427 17:28706585-28706607 GCTTGGTCCTGAGGCAGGGAGGG - Intronic
1146602872 17:34233884-34233906 GCTAGGACTTGCCACAGTGGTGG - Intergenic
1146632629 17:34481861-34481883 CCTAGGACTTGAGGCTGGGGAGG - Intergenic
1149571802 17:57677445-57677467 GCTAGGCCTGGAAGCAGGGATGG + Intronic
1152644675 17:81463259-81463281 GCTGGCACTGGAGGCAGGGAGGG - Intronic
1155642131 18:28030934-28030956 GCTAAGCCTTAAGGCACTGAAGG - Intronic
1156611524 18:38730570-38730592 GTTATGACTTGGTGCAGTGAAGG + Intergenic
1156794094 18:41019923-41019945 GCTAGGACTCATGGGAGTGAGGG + Intergenic
1158640139 18:59196635-59196657 GATAGGACAGGAGGCAGAGAGGG + Intergenic
1159999920 18:75007874-75007896 GCAAGGACCTGAGTGAGTGATGG - Intronic
1160848058 19:1175246-1175268 CCTGTGACTTGAGCCAGTGAAGG + Intergenic
1163495994 19:17646945-17646967 GCAAGGACTTGAGACAGGGATGG - Intronic
1165748016 19:38242157-38242179 TCTGGGACTTGGGGCAGGGAAGG - Intergenic
1167749795 19:51372663-51372685 GCAAGCAGTTGGGGCAGTGAGGG + Exonic
924980702 2:217947-217969 GCTTGGATTTGAGCCCGTGAAGG + Intronic
926429209 2:12768646-12768668 GGTAGGACAAGAGGCAGAGAGGG + Intergenic
926716438 2:15927937-15927959 GCTTGGAATTGAGGCAGTTGGGG + Intergenic
929362213 2:41105668-41105690 ATTAGGAGATGAGGCAGTGATGG - Intergenic
929996541 2:46829547-46829569 CCTAGGACGTGAGACAGTGACGG - Intronic
930611328 2:53547330-53547352 GCTAGGACTTGAGGCAGTGAGGG - Intronic
932634277 2:73374397-73374419 GCAAAGTCTTGAGGCAGGGAAGG + Intergenic
934920703 2:98342961-98342983 GGTAGGACTTCAGGCATTGATGG + Intronic
939079137 2:137639145-137639167 GCTGGGACTCCAGGCTGTGATGG - Intronic
940724978 2:157326726-157326748 GCTTGGGCTTGAGGAAGAGAAGG - Intronic
946359621 2:219211218-219211240 GCTAGGATATGGGGCAGTGATGG - Intronic
946971186 2:225093609-225093631 CCTTGGTCTTGGGGCAGTGAAGG - Intergenic
947747593 2:232516980-232517002 GCCTGGAGTGGAGGCAGTGAGGG + Intergenic
1170957609 20:20995670-20995692 GCTACGATTTGAGGCAGGGCAGG - Intergenic
1171976375 20:31597273-31597295 GCCAGGACTGGAGGCAGTGAAGG + Intergenic
1172011539 20:31848721-31848743 GCTGGGACTGGAGGGAGTGTGGG + Intronic
1172762301 20:37331397-37331419 GCTAGGACAGGAGTCAGTGAGGG - Intergenic
1173320675 20:41984379-41984401 ACTGGGAGTTGAGGTAGTGAGGG + Intergenic
1174431244 20:50471043-50471065 GCTAGGAGCTGGGGCAGTCATGG + Intergenic
1175074816 20:56363337-56363359 CCTGGGTCATGAGGCAGTGAGGG + Intronic
1175838455 20:62011624-62011646 GCCAGGACATGACCCAGTGAGGG + Intronic
1176175451 20:63721099-63721121 GCTAGGACTTTGGGAAGTGGAGG + Intronic
1177097072 21:16849270-16849292 TTTAGGACTAAAGGCAGTGATGG + Intergenic
1177785591 21:25668022-25668044 GCAAAGACTTGAAGAAGTGAGGG + Intronic
1177823816 21:26060702-26060724 GTGAAGACTTGAGGAAGTGAGGG + Intronic
1179409797 21:41153858-41153880 GCAAGGACTTGAGGAATTGTAGG + Intergenic
1179490644 21:41739294-41739316 CCAAAGGCTTGAGGCAGTGACGG - Intergenic
1180072803 21:45445120-45445142 GCCAGGACTGGAGGGAGGGAGGG - Intronic
1183316156 22:37137867-37137889 GAGAGGCCTGGAGGCAGTGAGGG - Intronic
1184254187 22:43277860-43277882 CCCAGGACTTGTGGCAGAGAAGG + Intronic
1185172834 22:49303666-49303688 GCCAGGACCTGGGGCAGAGAGGG + Intergenic
950136379 3:10584119-10584141 GCTTGGACTTGAGGCAGAGCAGG + Intronic
954067467 3:48118274-48118296 GCTGGGACAGGTGGCAGTGAGGG + Intergenic
954323016 3:49844699-49844721 GCTTGGCCTTGAGGCACTGCAGG - Intronic
954415677 3:50392186-50392208 GCAGGGACTTGAGGCTGGGAAGG - Intronic
954419907 3:50413233-50413255 GCCAGGACTGGGGGCAGTCAGGG + Intronic
954713669 3:52516833-52516855 GCTGGGCCTAGAGGAAGTGAAGG - Intronic
955404845 3:58619606-58619628 GATAGGACCTGGGGCACTGAAGG - Intronic
956533491 3:70249035-70249057 GCTAGGAAATGAGGAAGTGGAGG + Intergenic
958534841 3:95387344-95387366 GGTAGGGCTTATGGCAGTGATGG + Intergenic
963602337 3:147389522-147389544 GCTAAGACTTGAAGAAGTAAAGG - Intronic
965205243 3:165713436-165713458 GCATGCACTTGAGGCAGTGCTGG - Intergenic
965911281 3:173780508-173780530 GCTAGTACATGTGGCATTGAAGG - Intronic
974292788 4:59955177-59955199 GCTGGGACTGGAGGCAGGGGGGG + Intergenic
974439816 4:61901810-61901832 TCTAGGACTTGAATCAGGGAGGG - Intronic
984021720 4:174492852-174492874 GCTTGGAATTTAGGCAGAGAAGG + Intronic
984647852 4:182238591-182238613 CTTAGGACCTGGGGCAGTGACGG + Intronic
985116016 4:186591834-186591856 GCTAGGACATGATGCTGTCAAGG - Intronic
986757386 5:10850971-10850993 GCTAGGACTTTGGGTAATGAAGG - Intergenic
989004234 5:36792172-36792194 GCTAGAAGTTTAGGCATTGATGG + Intergenic
991212801 5:64125863-64125885 TCTAAGACTTGAGACATTGATGG + Intergenic
996832514 5:127755538-127755560 GCTATGGCTTGAGGCTGAGATGG - Intergenic
999022031 5:148176908-148176930 ACTAGGACACGAGGCACTGAAGG - Intergenic
999123998 5:149233023-149233045 GCAAGGACTTCAGGCTGTTAGGG - Intronic
1001629949 5:173167726-173167748 GCAAAGACTTGAGGCAGGGGAGG + Intergenic
1002390288 5:178906174-178906196 GCCAGGACTTAAGGTGGTGAGGG + Intronic
1002605307 5:180379631-180379653 GCAAAGACCTGAAGCAGTGACGG - Intergenic
1004561188 6:16752593-16752615 GCTAGAACTTGGGGCAGTAAGGG - Intronic
1005704312 6:28436206-28436228 GGAAGGACTTCTGGCAGTGAAGG - Exonic
1005804796 6:29464110-29464132 GCTGTAACTTGAGGCAGTGAAGG - Exonic
1006781509 6:36635631-36635653 TCCAGGACTTGAGGCAGTGAGGG - Intergenic
1007656956 6:43456133-43456155 GCTGAGACTTGAGGGAGGGAAGG - Exonic
1008307866 6:49926990-49927012 GCAATGACCTGAGGCAATGAGGG + Intergenic
1011160803 6:84388358-84388380 ACTAGCAGTTGAGGTAGTGAGGG - Intergenic
1012676142 6:102115395-102115417 GCTTGGACATGAAGCAGAGAGGG + Intergenic
1012771341 6:103438351-103438373 GCTAGGACTTGAGGTATTTGAGG + Intergenic
1016937103 6:149455597-149455619 GCTATGGCTGGAGGCAGAGAGGG - Intronic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1024150717 7:46569044-46569066 GCAAGGACATGCGGCAGAGACGG - Intergenic
1027319420 7:77002759-77002781 GCCAGGCCTTGAGGCAGGGCTGG + Intergenic
1029642267 7:101828785-101828807 GCTTGGATTTGGGGAAGTGAGGG + Intronic
1029682325 7:102120087-102120109 GCAGGAACTTGGGGCAGTGAGGG - Intronic
1030106431 7:105991108-105991130 GCCAGGACTGGGGGCAGAGAGGG + Intronic
1031050251 7:116937738-116937760 ACTTGGATATGAGGCAGTGAAGG + Intergenic
1035993001 8:4512986-4513008 GCCAGGAGTTGAGGGAGAGAAGG + Intronic
1037487896 8:19365748-19365770 GCTGGGACTTGACACAGGGATGG + Intronic
1038350473 8:26771729-26771751 GCTAGTGCTGGATGCAGTGAGGG - Intronic
1039457965 8:37720602-37720624 GCAGGGAATTGAGGCAGCGAAGG - Intergenic
1039465673 8:37783664-37783686 CCTAGTACATGAGGCACTGAGGG + Intergenic
1039807199 8:41010602-41010624 CTTGGGACGTGAGGCAGTGATGG - Intergenic
1043147270 8:76674081-76674103 GCTAGGACTTCGGACAGAGAGGG + Intergenic
1045328390 8:101134557-101134579 GCTATGACTGGAAACAGTGAAGG - Intergenic
1046595114 8:116252140-116252162 GCTAGGAGTAGAGGGAATGAGGG + Intergenic
1047415276 8:124659824-124659846 GCAATTACTTCAGGCAGTGAGGG + Intronic
1048694781 8:137013330-137013352 GCTAAGTATGGAGGCAGTGAAGG + Intergenic
1048913429 8:139158754-139158776 GCAGAGACTTGAGGCAGAGAAGG + Intergenic
1051218860 9:14827797-14827819 GCAGAGACTTGAGGCAGTGCTGG - Intronic
1057919139 9:99082347-99082369 GCTAGGACTTGAAGAAGGAAGGG - Intergenic
1058700998 9:107600100-107600122 GCTGGGCCTAGAGTCAGTGATGG + Intergenic
1060722554 9:125988676-125988698 GCAAAGACTTGAAGCAGTGGGGG - Intergenic
1061787539 9:133038944-133038966 GTTAGGATTAGAGGTAGTGATGG + Intronic
1185642297 X:1595167-1595189 GCTAAGTCTTGAGCCACTGATGG + Intronic
1187793174 X:22972963-22972985 ATGAGGAATTGAGGCAGTGAAGG + Intergenic
1188147984 X:26638205-26638227 GCAAGGACTTAAGGCAGTAGTGG - Intergenic
1189874949 X:45426395-45426417 GATAGTAATTGAGGCAGTAATGG - Intergenic
1190912813 X:54788224-54788246 GCTATGACTTGATTCAGTTAGGG + Intronic
1190918141 X:54825152-54825174 GCTATGACTTGATTCAGTTAGGG - Intergenic
1194539493 X:95153368-95153390 GCAATGACTTGAGGCAGTAATGG + Intergenic
1195719012 X:107847925-107847947 GACAGGAGTTGAGGCAGGGAAGG + Intronic
1197541113 X:127762853-127762875 GCTATGACTTCAGGCAATGTAGG + Intergenic
1198200517 X:134412248-134412270 GGTGGGACTTGAGGGAGTTAAGG - Intronic
1199771778 X:150979817-150979839 GCAAGGGCTTGAGGGAATGAAGG - Intergenic