ID: 930613553

View in Genome Browser
Species Human (GRCh38)
Location 2:53570108-53570130
Sequence ACGGGGACATTTAGTGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930613553_930613560 15 Left 930613553 2:53570108-53570130 CCATCAGCACTAAATGTCCCCGT 0: 1
1: 0
2: 0
3: 6
4: 69
Right 930613560 2:53570146-53570168 AACTCACCACCACCACCCAGAGG 0: 1
1: 0
2: 2
3: 27
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930613553 Original CRISPR ACGGGGACATTTAGTGCTGA TGG (reversed) Intronic
908087842 1:60655396-60655418 ACATGGACATTTAGGGATGAAGG + Intergenic
910308866 1:85800270-85800292 ATGGAGACATTTGGTTCTGAAGG - Intronic
922199885 1:223393150-223393172 AGGGTGACATTTAAAGCTGAGGG - Intergenic
1063070717 10:2660442-2660464 ACCCGCACACTTAGTGCTGAGGG + Intergenic
1063501650 10:6560490-6560512 ACGGGTTCATTTTGTCCTGATGG - Intronic
1068773911 10:60851288-60851310 ATGTGGACATTTTGTGGTGAGGG + Intergenic
1070775301 10:79106296-79106318 ACAGGGACATCAAGTGCTGTAGG + Intronic
1074744579 10:116519017-116519039 ACGGGAACCTTAAGTGCTCAAGG + Intergenic
1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG + Intronic
1077395781 11:2320508-2320530 GGGAGGACATTTAGTGCGGAGGG - Intergenic
1104768494 12:131345811-131345833 ACGGGTACAGTGAGTGCAGAGGG - Intergenic
1105634555 13:22204550-22204572 ACCTGGACATTTAATTCTGAAGG - Intergenic
1108699866 13:52934484-52934506 TCAGGGAGACTTAGTGCTGATGG + Intergenic
1113339690 13:109409840-109409862 ACGGGGAGATGATGTGCTGATGG - Intergenic
1113875014 13:113588799-113588821 TCGGGGACAGTGAGTGGTGATGG + Intronic
1119501497 14:75131805-75131827 ACTGGGACATTTTGTGCTTTTGG - Exonic
1126433542 15:48612295-48612317 ATGGGGAAATTTAGAGCTGAAGG - Intronic
1129208196 15:74049784-74049806 AGGGGCACATTTGGTGCTTAAGG + Intergenic
1141020534 16:80491880-80491902 ACGGAGACATTTATTGGTGTGGG + Intergenic
1141403814 16:83774016-83774038 ATGGGGACAGTCTGTGCTGATGG - Intronic
1149082246 17:52673038-52673060 ACGGGGAGATTGAGTGCTACAGG - Intergenic
1149224493 17:54453648-54453670 AAGGGGAAATTGAGAGCTGATGG + Intergenic
1158403658 18:57142598-57142620 AGGGGGACATTCAGGGCTGATGG + Intergenic
1158573263 18:58614561-58614583 ACGGGTACATTTGGTGGTTACGG + Intronic
1160718013 19:585204-585226 ACGAGGACACTAAATGCTGAGGG - Intergenic
1163072384 19:14855120-14855142 ACAGGGACATCGTGTGCTGAGGG - Intergenic
1166248057 19:41545111-41545133 ACCGAGACATTCAGTTCTGAGGG - Intergenic
925103397 2:1268744-1268766 ACTTGAACCTTTAGTGCTGATGG - Intronic
929881491 2:45840847-45840869 ATGGGGACATGTGGTGCTCATGG + Intronic
930613553 2:53570108-53570130 ACGGGGACATTTAGTGCTGATGG - Intronic
931144706 2:59504675-59504697 ACAGGGACATATATTTCTGAAGG + Intergenic
933391285 2:81671340-81671362 GCTGGGACATGTAGAGCTGATGG + Intergenic
935785545 2:106545302-106545324 ACGGTGACATTTAATGATTACGG - Intergenic
937446195 2:121960574-121960596 ATGGGGACATTGTGTGCTGTGGG + Intergenic
939650387 2:144755187-144755209 AGGGGGAATTTTAGTGATGATGG - Intergenic
942374275 2:175320827-175320849 ATGGGAAAATTTAGTGCTTAGGG - Intergenic
1173186140 20:40841829-40841851 GAGGGGACAAGTAGTGCTGAAGG - Intergenic
1173771762 20:45665964-45665986 ACGGGGACGTTTAGGTCTGCAGG + Intronic
1174797564 20:53534991-53535013 ACTGTGACATTTAGTGCTAACGG + Intergenic
1184475874 22:44720957-44720979 AAGGGGCCATTTGGTCCTGAAGG + Intronic
951510554 3:23496482-23496504 ACAGGGACATATACTACTGAGGG - Intronic
955963895 3:64368431-64368453 ACGGGGAGATTGATGGCTGAAGG - Intronic
956926188 3:73991302-73991324 ACAGGGACATTTAATTCTGCAGG - Intergenic
961851115 3:129819707-129819729 ACGGGAACAGTTAGAGTTGATGG + Intronic
964662402 3:159135008-159135030 ACCAGGACAGTTTGTGCTGATGG + Intronic
968544785 4:1193329-1193351 ACGGGGACACCCAGTGATGAAGG - Intronic
969704758 4:8785688-8785710 ACGGGGACACAGAGGGCTGAAGG + Intergenic
971014268 4:22471076-22471098 ACAGGAACAGTCAGTGCTGAAGG + Intronic
981066565 4:140492298-140492320 ACTGGGACATTTGGAGCTGAAGG - Intronic
991491048 5:67182848-67182870 ACCAACACATTTAGTGCTGAAGG - Exonic
991547572 5:67800347-67800369 AGGGGGGCATTAAGTGCAGAGGG + Intergenic
995614385 5:113944585-113944607 GCGGGCACATGGAGTGCTGAGGG - Intergenic
999089192 5:148920671-148920693 AAGGGCACATTTAGTAGTGAAGG + Intergenic
999217934 5:149951381-149951403 ACGGGGACACTTAGTGCCTCTGG - Intergenic
1000842633 5:166240396-166240418 ATGCAGAAATTTAGTGCTGAGGG + Intergenic
1000952450 5:167500880-167500902 AGGAGGACATTTAGTACTGGGGG - Intronic
1001822331 5:174720248-174720270 ATGGGGACATCTAGTTCTGGAGG - Intergenic
1007095345 6:39209450-39209472 ACAGAGCCATTTTGTGCTGAAGG + Intronic
1008796170 6:55305550-55305572 ATAGGGACATGTACTGCTGAGGG - Intergenic
1010736610 6:79450722-79450744 ACGGGGAATTTTATTGCTGATGG - Intergenic
1012397875 6:98820881-98820903 AGGGGGAAATTTAGAGCTGAAGG - Intergenic
1016207104 6:141481869-141481891 AAGGGGACGTTCTGTGCTGAGGG + Intergenic
1018742645 6:166742339-166742361 ACGAAAACATTTATTGCTGAGGG + Intronic
1025008469 7:55375417-55375439 AGGGGGGCATTCTGTGCTGAAGG - Intronic
1028147980 7:87340102-87340124 ACGGTAACATACAGTGCTGAAGG - Intergenic
1046204662 8:110977291-110977313 TCGGGGGCATTCAGTGCTCAGGG + Intergenic
1055311567 9:74987644-74987666 AAGGGGACATTTTGGGGTGATGG + Intronic
1058080021 9:100691306-100691328 ACGGGGACATTTAAGTCTGCAGG - Intergenic
1058349245 9:104001481-104001503 ACGGGCACATGTAATGCTTAGGG - Intergenic
1058783564 9:108364099-108364121 AGGGGGATATTGAGTGATGAGGG - Intergenic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1186989539 X:15052589-15052611 ACGGGCACATTTAGAGATCATGG + Intergenic
1187570948 X:20501069-20501091 AAGGGAACATTCAGGGCTGATGG - Intergenic
1188050547 X:25479803-25479825 AAGGGGACATTTTTTGATGAGGG + Intergenic
1200247875 X:154535499-154535521 ACGGGGACACTGACTTCTGAGGG - Intronic
1202105053 Y:21355008-21355030 ACAGGGACATTTAATTCTGCAGG - Intergenic