ID: 930613596

View in Genome Browser
Species Human (GRCh38)
Location 2:53570585-53570607
Sequence CATAGGTAAATACCTAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 971
Summary {0: 1, 1: 1, 2: 22, 3: 173, 4: 774}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930613596 Original CRISPR CATAGGTAAATACCTAGGAT TGG Intronic
900470668 1:2853123-2853145 CTTGGGTAAATACCCAGGAGTGG + Intergenic
900672408 1:3863500-3863522 CTTGGGTACATACCTAGGAGTGG - Intronic
901121900 1:6902217-6902239 CTTAGGTAAATACCTAGAAGTGG - Intronic
901398098 1:8996525-8996547 TTTGGGTTAATACCTAGGATTGG + Intergenic
902180089 1:14681374-14681396 CCTGGGTAAATATCTAGGACTGG + Intronic
902252949 1:15167537-15167559 CTTGGGGAAATACCTAGGAGTGG + Intronic
902672739 1:17986129-17986151 CATTGTTGAATACATAGGATGGG + Intergenic
902966648 1:20009490-20009512 CTTAAATAAATACCTAGGACTGG - Intergenic
903144916 1:21365256-21365278 CTTGGGTATATACCTAGGAGTGG - Intergenic
904105011 1:28072717-28072739 CTTAGGTAGATACCTCGGAATGG - Intronic
905002930 1:34687553-34687575 CTCAGGTAAAAACCTAGGAGTGG + Intergenic
905520842 1:38598421-38598443 CTTTGGTAAATACCTAGGAGTGG - Intergenic
905759069 1:40538510-40538532 CGTGGGTATATACCTAGGAGGGG + Intronic
907018380 1:51040464-51040486 CATAATTGACTACCTAGGATTGG + Intergenic
907216100 1:52865458-52865480 CTTCAGTAAATACCTAGGAGTGG - Intronic
908280289 1:62526563-62526585 CTTAGGTAGATACCTAAGAGTGG - Intronic
908289217 1:62645189-62645211 CTTGGGTATATACCTAGGATAGG - Intronic
908400440 1:63767943-63767965 CTTGGGTTAATACCTAGGAGTGG + Intergenic
909083293 1:71141480-71141502 GTTAGGTATATACCTAGGATTGG + Intergenic
909515971 1:76507778-76507800 CTTGGGTAAATACCTAGAAGTGG + Intronic
909989608 1:82207101-82207123 CTTTGATAAATACCTAGGAGGGG - Intergenic
910536071 1:88299117-88299139 CCTAGTTAAATGCATAGGATTGG - Intergenic
911694038 1:100867578-100867600 CTTAGGTAAATACCTAGGCATGG + Intergenic
911986207 1:104627042-104627064 TTTAGGTAAATACCTAGAAATGG + Intergenic
913219088 1:116645000-116645022 CTTGGGTAAATACTTAGGAGTGG - Intronic
913323097 1:117604162-117604184 TATATATATATACCTAGGATTGG - Intergenic
913338830 1:117735840-117735862 CTAGGGTAAATACCTAGGAATGG + Intergenic
913411355 1:118555382-118555404 CATAGGTAAACACATATCATGGG - Intergenic
914326940 1:146627502-146627524 CTTGGGTATATACCTAGGAGTGG - Intergenic
914715724 1:150253390-150253412 CTTGAGTAAATACCTAGGAGTGG - Intergenic
915613147 1:157011969-157011991 CTTGGGTATATACCTAGGAGTGG - Intronic
915773650 1:158458043-158458065 CTTTGGTACATACCTAGGAGTGG - Intergenic
916101648 1:161398261-161398283 TCTTGGTAAATACCTAGGAGTGG + Intergenic
916158299 1:161880747-161880769 CTTGTGTAAATACCTAGGAGTGG + Intronic
916514659 1:165504694-165504716 CTTGGGTATATACCTAGGAGTGG - Intergenic
917047168 1:170873932-170873954 CGTGGGTAAATACCTTGGAATGG + Intergenic
917156642 1:172007160-172007182 CTTAGGAAAATACCTAAGAGAGG + Intronic
918509472 1:185294685-185294707 CTTGGGTAAATACCTACGAATGG + Intergenic
918575811 1:186058455-186058477 CAAAGGAAAATAACTATGATGGG + Intronic
918811684 1:189130182-189130204 CTTGGGTAAATATCTAGGAATGG - Intergenic
919291618 1:195640708-195640730 CTTGGGTAAATACCTAGAAGTGG - Intergenic
919292884 1:195655392-195655414 CTTGGGGAAATACCTAAGATTGG - Intergenic
921204703 1:212838550-212838572 CTAGGGTAAATACCTAGGAATGG - Intronic
921268389 1:213445333-213445355 CTTGGGTATATACCTAGGAGTGG + Intergenic
921958498 1:221009690-221009712 CTTGAATAAATACCTAGGATTGG + Intergenic
922010736 1:221583279-221583301 CTTAGGTAAATATCTAAGAGTGG - Intergenic
922497092 1:226066235-226066257 GAGAGCTTAATACCTAGGATGGG + Intronic
922500906 1:226096265-226096287 CCTACTTAAAAACCTAGGATAGG - Intergenic
922529143 1:226329899-226329921 CTTGGGTAAATACCTAGGAATGG + Intergenic
923059651 1:230459160-230459182 TTTAGGTAAATACTTAGGAGTGG + Intergenic
923132658 1:231090946-231090968 CATAGGTAAGTACTTAGACTAGG + Intergenic
923333447 1:232946911-232946933 CAAAGGTAAAAATCTAGGCTGGG - Intergenic
923673540 1:236062064-236062086 CTTGGGTATATACCTAGGACTGG - Intronic
924161813 1:241240791-241240813 TATAGGTAAACGGCTAGGATCGG + Intronic
924478439 1:244403496-244403518 CTTAGGTAGATACCTAGGAATGG - Intergenic
1063274192 10:4546571-4546593 CTTGGGTAAATACCTAGGAAAGG + Intergenic
1063291346 10:4753089-4753111 CATAGATAAATACATTGGACTGG - Intergenic
1063537436 10:6898224-6898246 CTTAGATAAATACCTAGGAAAGG - Intergenic
1063746362 10:8887872-8887894 GTTGGGTAAATACCTAGGAGCGG - Intergenic
1063814114 10:9752852-9752874 CCTGGGTAAAGCCCTAGGATTGG - Intergenic
1063893097 10:10650817-10650839 TTTAGGTACATACCTAGGAGTGG - Intergenic
1064191823 10:13213100-13213122 CTTGGGTAAATACCTAGGAATGG + Intergenic
1064343738 10:14510902-14510924 CTTGGGTAAATACTTAGGAGCGG + Intergenic
1064355971 10:14618409-14618431 CTTGGGTAAAAACCTAGGAGTGG + Intronic
1064568939 10:16672353-16672375 CTTGGGTAAACACCTAGGAGTGG - Intronic
1064654068 10:17539295-17539317 CTTGGGTATATACCTAGGAGTGG + Intergenic
1064661239 10:17610046-17610068 CTTGGGTAAATACCTAGGAGTGG - Intronic
1065196541 10:23271421-23271443 CTTGGGTAAATACCAAGGAGTGG + Intronic
1066080282 10:31924192-31924214 CTTGGGTAAATACCTAGAAGAGG - Intronic
1066104573 10:32145339-32145361 CCTAGGTAACTGCCTAGGGTTGG + Intergenic
1066378521 10:34881482-34881504 CTTGGGTAAATGCCTAGGAGTGG - Intergenic
1066423942 10:35287962-35287984 CTTGGGTAAATACCTAGGAGAGG + Intronic
1066499627 10:35978313-35978335 CTTGGGTAAATACTTAGGATTGG + Intergenic
1067072579 10:43145903-43145925 TTTAGGTAAATATCTAGGAATGG + Intronic
1067361905 10:45589915-45589937 CTTGGGTATATACCTAGGAGTGG + Intronic
1067384391 10:45805436-45805458 CTTGGGTAGATCCCTAGGATTGG + Intergenic
1067457457 10:46429915-46429937 AATAAATAAATACCTAGGAGAGG + Intergenic
1067629741 10:47954718-47954740 AATAAATAAATACCTAGGAGAGG - Intergenic
1068737978 10:60436318-60436340 CTCAGGAAAATACCTAGGAGTGG + Intronic
1068925931 10:62538304-62538326 CTAGGGTAAATACCTAGGAGTGG - Intronic
1070070756 10:73086988-73087010 CTTGGGTAAATACCTAGGAGCGG + Intronic
1070270076 10:74945012-74945034 CTTGGGTAAATACCTAGGAGTGG - Intronic
1070443838 10:76474842-76474864 CCTGGGTATATACCTAGGAGTGG - Intronic
1070443841 10:76474847-76474869 CCTAGGTATATACCCAGGAGAGG + Intronic
1070518690 10:77232261-77232283 GTTGGGTAAATACCTAGGAGTGG + Intronic
1070576749 10:77685051-77685073 CTTGGGTATATACCTAGGAGTGG - Intergenic
1070579289 10:77707465-77707487 TTTGGGTAAATACCTAGGAGTGG - Intergenic
1071010296 10:80931373-80931395 CTTGGGTACACACCTAGGATTGG - Intergenic
1071106134 10:82097616-82097638 CTTAGGTAAAGACCTAGGAGTGG + Intronic
1072073666 10:91946436-91946458 CTCAGGTAGATACCTAGGAGTGG + Intronic
1072193918 10:93098632-93098654 CTTGAGTAAATACCTAGGAGTGG + Intergenic
1073006450 10:100329040-100329062 CAAAGGTAAATAGATGGGATTGG + Intronic
1073590859 10:104756484-104756506 CAGGGGTAAATAACTAGGAAGGG + Intronic
1073673938 10:105623837-105623859 CTTAGGTAAATACCTAGGAGTGG + Intergenic
1073803847 10:107073721-107073743 CCTAGGTAAATACAGAGGATTGG - Intronic
1074270438 10:111948335-111948357 CTTGGGTAAATACCTTGGAGTGG - Intergenic
1074486094 10:113882207-113882229 CATGGGTAGATACCTAGAATTGG + Intronic
1074564120 10:114561459-114561481 AATAGGTAAAAACATAGGGTGGG + Intronic
1074593492 10:114838015-114838037 CTTGGATAAATACCTAGGGTAGG + Intronic
1074619449 10:115104044-115104066 TTTAGGTAAATACCTAGCAGTGG + Intronic
1074758309 10:116644544-116644566 CTTGGGTATATACCTAGGAGTGG + Intronic
1074952267 10:118348913-118348935 CTTAGGTAAATACCTAGGCACGG + Intergenic
1074970879 10:118536369-118536391 CTTAAGTAAATACCTAGAAGTGG + Intergenic
1075398607 10:122145166-122145188 CATAGGTAAATATCTAAAAATGG - Intronic
1076081285 10:127583381-127583403 TTTAGGTAAATACATAAGATTGG + Intergenic
1076321618 10:129586734-129586756 CTTAGGTAAACACCTAGGAGTGG + Intronic
1076681591 10:132174617-132174639 CTTGGGTAAATACCTAGGATTGG + Intronic
1077149972 11:1068131-1068153 GCCAGGTAAATACCTAGGAGTGG - Intergenic
1077657221 11:4031396-4031418 CTTAGGTAAATACCTAGGAGTGG + Intronic
1077822963 11:5768565-5768587 TTTGGGTAGATACCTAGGATTGG + Intronic
1077924338 11:6665779-6665801 CTTGGGTAGATACCTAGGAGTGG + Intergenic
1078588413 11:12615781-12615803 TATGGGTAAATACCCAGGAGTGG - Intergenic
1078592237 11:12652922-12652944 CTTGGGTTAATCCCTAGGATAGG - Intergenic
1078910725 11:15729384-15729406 CATTTGTAAAAATCTAGGATTGG - Intergenic
1079020028 11:16902344-16902366 CTTGGGTATATACCTAGGAATGG + Intronic
1079551343 11:21702639-21702661 TATAGGTAAATACCTAAAAGTGG + Intergenic
1080150291 11:29044826-29044848 CATAGGTAAACACCTGTAATGGG - Intergenic
1080325497 11:31067529-31067551 CATAGGTATATAACTAGGAGTGG - Intronic
1080561693 11:33469524-33469546 CTTAGGTATATACCTAGGAATGG + Intergenic
1080899533 11:36475315-36475337 CTTAGATAGATACCTAGGAATGG - Intergenic
1080986896 11:37479103-37479125 CTTAGATAAATACCAAGGAGTGG + Intergenic
1082649805 11:55775923-55775945 AATGGGTAAATACCCAGGAAAGG - Intergenic
1083200249 11:61116979-61117001 CTTGGGTAAATACCTAGGAATGG - Intronic
1083279387 11:61617191-61617213 CTTAGGTATATACCTAAGAGTGG + Intergenic
1083483280 11:62963882-62963904 CTTGGGTAAATACCTAGAAGTGG + Intronic
1084100756 11:66947126-66947148 CTTGGGTAAATGCCTAGGAGTGG - Intronic
1085425106 11:76397471-76397493 CTTAGGTATACACCTAGGAGCGG + Intronic
1085487341 11:76876557-76876579 CATAGGTAAATGCTTAGGATTGG + Intronic
1085546536 11:77323577-77323599 CTTGGGAATATACCTAGGATTGG - Intronic
1085654475 11:78300455-78300477 CCTGGTTAAATACCTAGGAGTGG + Intronic
1085673262 11:78489739-78489761 CTTGGGTAAATTCCTAGGAGTGG - Intronic
1085781826 11:79416242-79416264 CTGGGGTAAATACCTAGGAGTGG + Intronic
1086234540 11:84612436-84612458 CTTCAGTAAATACCTAGGAGTGG + Intronic
1086519393 11:87652319-87652341 CTTGGGTAAACACCTAGGAGTGG - Intergenic
1086809938 11:91296864-91296886 CTTGGGTATATACCTAGGGTTGG - Intergenic
1086996492 11:93362686-93362708 CTTGGGTATATACCTAGGAGTGG - Intronic
1087263064 11:96032263-96032285 CTTAAATAAATACCTAGGAGTGG - Intronic
1087329413 11:96761088-96761110 TATAACTAAATACCTAAGATTGG - Intergenic
1087365066 11:97208415-97208437 CTTTGGTAAAAACCTAGGAGTGG + Intergenic
1087636461 11:100707252-100707274 CTTGGGTATATACCTAGGAGTGG + Intronic
1088140528 11:106610606-106610628 CTTAGGTAAATACCTAGAGTAGG + Intergenic
1088841458 11:113630700-113630722 TCTAGGTAAAGCCCTAGGATGGG + Intergenic
1088904642 11:114145302-114145324 CTTGGGTATATACCTAGGAGTGG - Intronic
1088922589 11:114271990-114272012 CAGAGGTGAATACCTGGGAGAGG + Intronic
1089374009 11:117981620-117981642 CATAGGTTAATACCTAGCTCAGG - Intergenic
1089628348 11:119766272-119766294 CTTTGATAAATACCTAGGAGTGG + Intergenic
1089718497 11:120388469-120388491 CTTAGGTAAACACCCAGGAGTGG + Intronic
1091063376 11:132485892-132485914 CTTAAATAAATACCTAGGAGTGG + Intronic
1091180816 11:133602816-133602838 CTCAGGCAAATACCTAGGAGTGG + Intergenic
1091535134 12:1399890-1399912 CTTGAGTATATACCTAGGATTGG + Intronic
1092167412 12:6351032-6351054 CTTGGGTATATACCTAGGAATGG - Intronic
1092267520 12:6994171-6994193 CTTGGGTATATACCTAGGAATGG + Intronic
1093043310 12:14411130-14411152 CTTGGGTATATACCTAGGAATGG + Intronic
1093906633 12:24701193-24701215 CTTGGGTAGATACCTAGGAGTGG - Intergenic
1094377701 12:29808893-29808915 GTTGGGTAAATACCTAGGAGTGG - Intergenic
1094571845 12:31648006-31648028 CTTGGGTATATACCTAGGAATGG - Intronic
1094607792 12:31964030-31964052 TTTGGGTAAATACCTAGGAGTGG + Intronic
1094633993 12:32206196-32206218 GATAAATAAATACCTAGGAGTGG + Intronic
1094686053 12:32715883-32715905 CATGGTTAAACACCTAGGAACGG - Intronic
1094686138 12:32716901-32716923 CATGGTTAAACACCTAGGAATGG + Intronic
1095361560 12:41347150-41347172 CTTGGGTATATACCTAGGAGAGG + Intronic
1095555957 12:43504956-43504978 CTTAGATAAATACCTAGGGGTGG - Intronic
1095999361 12:48115939-48115961 CGTAGGTATATACCTAGGAGTGG + Intronic
1096391502 12:51232802-51232824 CTTGGGTAAATACCTAGGAGTGG + Intergenic
1096762991 12:53858977-53858999 CTTAGGTATATACCTAGAAGTGG - Intergenic
1097160394 12:57042488-57042510 CTTGGGTATATACCTAGGAGTGG + Intronic
1097374785 12:58828584-58828606 CATAGGTAAATATGTATCATGGG - Intergenic
1097651343 12:62301325-62301347 TCTGGGTAAATACCTAGGAGTGG - Intronic
1097706217 12:62871047-62871069 CTTGGGTACATACCTAGGAGTGG - Intronic
1097750410 12:63346204-63346226 CTTAGGTAAATAACTAGGTATGG + Intergenic
1097769233 12:63561782-63561804 CTTAGGGAAACACCTAGGAGTGG + Intronic
1098928397 12:76379860-76379882 CATGGGCAAATACCTAGGAGTGG + Intronic
1098988571 12:77039797-77039819 CTTGGGTAAATACCTAGGAATGG - Intronic
1100520065 12:95366063-95366085 AGTAAATAAATACCTAGGATTGG + Intergenic
1101103239 12:101415971-101415993 CTTGGGTATATACCTAGGAGTGG + Intergenic
1101820033 12:108176650-108176672 CTTGGGCAAATACCTAGGAGTGG + Intronic
1101974573 12:109345598-109345620 CTTGGGTATATACCTAGGAGTGG - Intergenic
1102265311 12:111479085-111479107 TTTAGTTAAATACCTAGAATTGG - Intronic
1102305403 12:111800808-111800830 CTTGGATAAATACCTAGGAGTGG - Intronic
1102366337 12:112339071-112339093 TATAGGGAATTACCTAGGAGTGG - Intronic
1102553386 12:113709440-113709462 CTTGGGTAAATACCTAAGAGTGG + Intergenic
1102656533 12:114486554-114486576 CTTGGGTAAATACATAGGAGTGG + Intergenic
1102662439 12:114541313-114541335 CTTAGGTAAATACCTAAGAGTGG - Intergenic
1102665301 12:114566988-114567010 CTTAGGTAAATACCTAAGAGTGG + Intergenic
1102881694 12:116490193-116490215 CTCAGGTATATACCTAGGAGTGG - Intergenic
1102901520 12:116641564-116641586 CTTGGGTATATACCTAGGAGTGG - Intergenic
1103178079 12:118881916-118881938 CCTAGGTATATAGCTAGGAATGG + Intergenic
1103220805 12:119243131-119243153 CCTTGGTATATACCTAGGAGCGG + Intergenic
1103299346 12:119916185-119916207 CTTGGGTAAATACCTAAGAGTGG + Intergenic
1103549351 12:121725467-121725489 CTTGGGTAGATACCTAGGAATGG - Intronic
1103634688 12:122293977-122293999 CATGGGTAAACACCTAAGAGTGG - Intronic
1103964481 12:124630025-124630047 CTTGGGTGAATACCTAGGAGTGG + Intergenic
1104071188 12:125347079-125347101 CCTAGGTGAATTCCTGGGATGGG + Intronic
1104078978 12:125413844-125413866 TTTAGGTATATACCTAGGAGTGG + Intronic
1104094734 12:125546777-125546799 CTTGGGTATATACCTAGGAGTGG + Intronic
1104124090 12:125828691-125828713 TGTAGGTAAATACCTAGGAATGG - Intergenic
1104884363 12:132096906-132096928 CCTAGGTAAGTACCTAGGAGTGG + Intronic
1105664340 13:22535530-22535552 CTTAGGTAAATACATAGGTGTGG - Intergenic
1106000241 13:25715804-25715826 CTTGGGTATATACCTAGGAGTGG + Intronic
1106214018 13:27678214-27678236 CTTGGGTAAATATCTAGGAATGG - Intergenic
1106736835 13:32596504-32596526 CTTGAGTAAATACCTAGGAATGG + Intronic
1106878004 13:34096620-34096642 CTTAGGTATATAGCTAGGAATGG - Intergenic
1106984495 13:35329330-35329352 CTTGGGCAAATACCTAGGCTTGG - Intronic
1107300947 13:38965116-38965138 CATAGGCAGAAACCTAAGATAGG - Intergenic
1107445198 13:40464344-40464366 CTTGGGTTAATACCTAGGAGTGG + Intergenic
1107504712 13:41022042-41022064 CTTGGGTAAATGCCTAGGAATGG - Intronic
1108234936 13:48393933-48393955 CATAAGAAAATACTTAGGATGGG + Intronic
1108427789 13:50322084-50322106 CTTAGGTAAAAACCTATGAGTGG + Intronic
1108494540 13:51011116-51011138 CTTAAGTAAATACCTAGAAGTGG + Intergenic
1108841186 13:54617413-54617435 CAAAGTTATATACCTAGGAATGG + Intergenic
1109299791 13:60579405-60579427 CATGGGTAAAGAACTAGGAGTGG - Intergenic
1109351093 13:61181841-61181863 CTTGGGTAAATACCTAGGAGTGG + Intergenic
1109401118 13:61829755-61829777 TATAAGTAAATACCTGAGATTGG - Intergenic
1110019816 13:70456373-70456395 CATAGTAAAATACCTGGGTTTGG + Intergenic
1110201453 13:72854704-72854726 CTTGGCTAAATACCTAGGAGTGG + Intronic
1110378099 13:74816728-74816750 TATAGTTATATACCTAGGAGTGG - Intergenic
1111077811 13:83262108-83262130 CTTGGGTATATACCTAGGAGTGG + Intergenic
1111270435 13:85874986-85875008 CTTAGGTTCATACCTAGAATTGG + Intergenic
1111978189 13:94989599-94989621 CTTGGGTAAATAGCTAGGAGTGG + Intergenic
1112150515 13:96755838-96755860 CATTGGCTAATACCTAGGAGTGG + Intronic
1112232045 13:97598754-97598776 CATAGGTAAATATCTAACAGTGG - Intergenic
1112613455 13:100978825-100978847 CCTGGGTAAATACCAAGGAGTGG - Intergenic
1112625219 13:101096210-101096232 CTTGGGTAGATACCTAGGAGTGG - Intronic
1113196612 13:107815625-107815647 CTTAGGTGTATACCTAGGAGTGG - Intronic
1113452085 13:110417903-110417925 CTTAGGTATATACCTAGGAGTGG + Intronic
1113499493 13:110761911-110761933 TATAAATAAATACCTGGGATTGG - Intergenic
1113545625 13:111147201-111147223 CTTGGGTAAATACCTAGGAAAGG + Intronic
1114279409 14:21177566-21177588 CTTGGGTATATACCTAGGAGTGG + Intergenic
1114370939 14:22087339-22087361 TATAGATAAATACTTAGGAGTGG - Intergenic
1114691000 14:24581154-24581176 CTAGGGTATATACCTAGGATTGG - Intergenic
1114745795 14:25145389-25145411 CTTGGGTAAGTACCTAGGATTGG + Intergenic
1114861822 14:26532174-26532196 CTTGGGTAAATACTTAGGAATGG - Intronic
1115557377 14:34554151-34554173 CATAGGTAAATTCGTAGGTTAGG + Intergenic
1116117069 14:40667731-40667753 TAGGGGTAAATACCTAGAATGGG + Intergenic
1116316913 14:43408714-43408736 CATAGATAAATACCTAAGAGTGG - Intergenic
1116689955 14:48093102-48093124 CTAAGGTAAATACCTAGGATTGG + Intergenic
1117828875 14:59730991-59731013 CTTGGGTAGATACCTAGGAGTGG - Intronic
1117865269 14:60141874-60141896 CTTGGGCAAATACCTAGGACTGG + Exonic
1117893964 14:60459381-60459403 TCTAGGTATATACCTAGGATCGG + Intronic
1118418049 14:65565510-65565532 CTTGGGCAAATACCTAGGAGTGG + Intronic
1118424224 14:65641513-65641535 CTTGGCTAAATACCTAGGAGTGG + Intronic
1118738439 14:68719672-68719694 CTTGGGTATATACCTAGGAATGG + Intronic
1118996023 14:70836974-70836996 CATTTATAAATACCTAGGAGTGG - Intergenic
1119013954 14:71030021-71030043 CTTGGGTAAATACCTAGAAATGG + Intronic
1119178836 14:72590275-72590297 CTTGGTTAAATACCTAGGATGGG - Intergenic
1119297033 14:73541364-73541386 CGTGGGTAGATACCTAGGAGTGG + Intronic
1119301273 14:73573265-73573287 CGTGGGTAGATACCTAGGAGTGG + Intronic
1119454368 14:74742041-74742063 CTTGGGTAGATACCTAGGAGTGG - Intergenic
1120735825 14:88051325-88051347 CATCAGTATATACCTAGGAGCGG + Intergenic
1120740122 14:88099281-88099303 CTTTGGTATATACCTAGGAGTGG - Intergenic
1120952897 14:90059306-90059328 CTTACGTAAAGACCTAGGAGCGG - Intergenic
1121306056 14:92907842-92907864 CTTGGGTAAGTACCTAGGAGTGG + Intergenic
1121384511 14:93507247-93507269 CTTGGGTATATACCTAGGACTGG + Intronic
1121446006 14:93979586-93979608 CTTGGGTATACACCTAGGATGGG + Intergenic
1121641618 14:95488479-95488501 CTTGTGTAAATACCTAGGAGTGG + Intergenic
1121715804 14:96072981-96073003 CTTGGGTAAATACGTAGGAGTGG + Intronic
1122024499 14:98865742-98865764 TTTAGGTAAATACCTAGGAATGG - Intergenic
1122390661 14:101380321-101380343 TATAGATATATACCTAGGAGGGG - Intergenic
1122583764 14:102789361-102789383 CTTGGGTATATACCTAGGAGTGG + Intronic
1122995097 14:105259120-105259142 CTTGGGTAAATACCTAGGAGTGG - Intronic
1123475214 15:20586620-20586642 CATTGATAAATACATAGGAGTGG - Intergenic
1123677773 15:22728497-22728519 CTTGGGTAAATACTTAGGAGTGG + Intergenic
1123711937 15:22994707-22994729 CTTGGGTAAACACCTAGGAGTGG + Intronic
1123723336 15:23079209-23079231 CATCGTGAAAGACCTAGGATTGG + Intergenic
1123723353 15:23079335-23079357 CATCGTGAAAGACCTAGGATTGG + Intergenic
1124104763 15:26727293-26727315 CATAAGTAAATACCTAAGGAAGG - Intronic
1124329975 15:28802761-28802783 CTTGGGTAAATACTTAGGAGTGG + Intergenic
1125062649 15:35442514-35442536 CTTGGGTATATACCTAGGAGTGG - Intronic
1125178515 15:36853877-36853899 CTTAGGTAAATACTTAAGAGTGG - Intergenic
1125312448 15:38394906-38394928 CTTGGGTATATACCTAGGAGTGG + Intergenic
1126145248 15:45467750-45467772 CATGGGTAAATACCAAAGAACGG + Intergenic
1126489282 15:49218791-49218813 GTTGGGTAAATACCTATGATTGG + Intronic
1126934467 15:53690805-53690827 TTTAGGTATATACCTAGGAGTGG + Intronic
1127037906 15:54939690-54939712 CTTAGGTAAGCACCTAGGAGTGG + Intergenic
1127100926 15:55564057-55564079 CTTGGATAAATACCTAGGAGAGG - Intronic
1127141476 15:55982260-55982282 CTTGTGTAAATACCTAGGAATGG - Intronic
1127178365 15:56385936-56385958 CTTGGGTAAATATCTAGGAAGGG - Intronic
1127334957 15:57975188-57975210 CTTAGGTAAATACCTAGGAATGG - Intronic
1127362655 15:58258600-58258622 CTTGGGTACATACCTAGGAATGG - Intronic
1127442904 15:59028726-59028748 CTTGGGTACATACCTAGGAGTGG + Intronic
1127560137 15:60128046-60128068 CTTAGATAATTACCTAGGAGGGG - Intergenic
1127607532 15:60603265-60603287 TATTGGTAAATACCTAGGAATGG + Intronic
1127677529 15:61256407-61256429 CCTGGTTAAATACCTATGATTGG - Intergenic
1127688882 15:61375441-61375463 CTTGGGTACATACCTAGGAGTGG + Intergenic
1127835193 15:62785050-62785072 CATACATAAATATCTAGCATGGG + Intronic
1128422331 15:67505466-67505488 CTTGGGCAAATACCTAGGAGTGG - Intergenic
1128437580 15:67669932-67669954 CTTAGGTAAATATCTAGGAAGGG - Intronic
1128438530 15:67680321-67680343 CTTGAGTAAATACCTAGGAGTGG + Intronic
1128492238 15:68159831-68159853 CTTGGGTAAATACCTAGGAGTGG + Intronic
1129624670 15:77184457-77184479 CTTGGGTAAATACCTAGGAGTGG - Intronic
1130143464 15:81252977-81252999 CTTGGGTATATACCTAGGAATGG + Intronic
1130367133 15:83250799-83250821 CCTGGGTATATACCTAGGAGTGG - Intergenic
1130426122 15:83802348-83802370 CTTGGGTAAATACCTAGAAGTGG - Intronic
1130618963 15:85441070-85441092 CATATGTAGATACCTAGGAGTGG + Intronic
1131447131 15:92509790-92509812 CAGAGGTATATACCTAGGAGTGG - Intergenic
1132050339 15:98602520-98602542 CTTAGGTAAACACCTAGGAGTGG - Intergenic
1132350219 15:101134866-101134888 CTTGGATAAATACCTAGGAGAGG + Intergenic
1133016820 16:2946984-2947006 CCTGGGTACATACCTAGGAGTGG - Intronic
1133332713 16:4985960-4985982 CTTGGGTATATACCTAGGAGTGG + Intronic
1133595184 16:7284275-7284297 CCTGGGTAAATTCCTAGGAGTGG + Intronic
1134035782 16:11030250-11030272 CTTGGATAAATACCTAGGAATGG + Intronic
1134278378 16:12796713-12796735 TTTGGGTAGATACCTAGGATTGG - Intronic
1135054244 16:19217697-19217719 CTTAGGTATACACCTAGGAATGG + Intronic
1135555062 16:23429341-23429363 CTTGGGTAAATACCTAGGAGTGG - Intronic
1135623002 16:23971900-23971922 CTTGGATAAATACCTAGGAGTGG - Intronic
1135817172 16:25645126-25645148 CTTGGGTAAATACCCAGGAGTGG - Intergenic
1135834601 16:25813720-25813742 CTTGGGTAAATATCTAGGAGTGG - Intronic
1135908114 16:26532403-26532425 CTTAGGTAAATATCTAGGAGAGG + Intergenic
1136354617 16:29736078-29736100 CATAGGTTAAGACATAGGTTTGG + Intergenic
1136722273 16:32335811-32335833 AATAAGTAAATAAATAGGATGGG - Intergenic
1136840590 16:33541790-33541812 AATAAGTAAATAAATAGGATGGG - Intergenic
1137445695 16:48530824-48530846 CTTAGGTAAATACCTAGGAATGG + Intergenic
1137702795 16:50509047-50509069 CTTGGGTAAATACTTAGGAGTGG + Intergenic
1138065793 16:53939995-53940017 CTTGGGTATATACCTAGGAATGG + Intronic
1138139433 16:54555301-54555323 CTTGGGTGAATACCTAGGATGGG - Intergenic
1138253198 16:55524070-55524092 CTTAAGTAAATACCTAGCAGTGG - Intronic
1138402149 16:56755122-56755144 CTTAGGTATATACCTATGAGTGG - Intronic
1138901826 16:61280784-61280806 CTTAGGCATATACCTAGGAGTGG + Intergenic
1139058239 16:63214621-63214643 CTTGGGTAAAGACCTAGGAGTGG - Intergenic
1139286061 16:65815443-65815465 CTTGGGTAGATACCTAGGAGTGG + Intergenic
1139731511 16:68949774-68949796 CATGGGTATATACCTAGGAGTGG - Intronic
1139839117 16:69864061-69864083 CATGGGTAAATACCTAGGAGAGG + Intronic
1140006621 16:71083438-71083460 CTTGGGTATATACCTAGGAGTGG + Intronic
1140556665 16:75929430-75929452 CATACATACATACCTATGATAGG - Intergenic
1140608223 16:76566557-76566579 CTTAGGTAAATGCCTAGAATTGG + Intronic
1140962043 16:79925052-79925074 CTCTGGTAAATACCTAGGAATGG - Intergenic
1141074784 16:80994802-80994824 CTTGGGTAAATACCTAGGAATGG - Intronic
1141579503 16:84987587-84987609 CTTGGGTATATACCTAGGAGTGG - Intronic
1141757847 16:86004429-86004451 CTTAGGTAAACGCCTAGGAGGGG + Intergenic
1141941971 16:87283007-87283029 CTTGGGTATATACCTAGGAGTGG - Intronic
1141946492 16:87314154-87314176 CTTGGGTAAATACCAAGGAGTGG - Intronic
1203004158 16_KI270728v1_random:181953-181975 AATAAGTAAATAAATAGGATGGG + Intergenic
1203135766 16_KI270728v1_random:1718360-1718382 AATAAGTAAATAAATAGGATGGG + Intergenic
1203150755 16_KI270728v1_random:1842087-1842109 AATAAGTAAATAAATAGGATGGG - Intergenic
1142786413 17:2227214-2227236 CTTACGTAAGTACCTAGGAATGG - Intronic
1143003272 17:3809322-3809344 CTTGGGTATATACCTAGGAGTGG - Intergenic
1143440527 17:6969508-6969530 CTTGGGTAAACACCTAGGAGTGG - Intronic
1143507538 17:7376332-7376354 CTTTGGTAAATACCTAGGAGTGG - Intergenic
1143718266 17:8791544-8791566 CTTGGGTAAATACCAAGGAGTGG - Intergenic
1143756172 17:9069236-9069258 AATAGGAAAATTCCTAGGAGGGG - Intronic
1144045858 17:11453987-11454009 CTTGGGTAAATATCTAGGAGAGG + Intronic
1145738145 17:27248177-27248199 CTTGGGTATATACCTAGGAGTGG + Intergenic
1145848505 17:28066618-28066640 CTTGGGTAAATACCTAGGAGTGG + Intronic
1145851307 17:28100181-28100203 CTTGGGTAAATACTTAGGAATGG + Intronic
1146410545 17:32579988-32580010 CCTAGATAAATATCTAGGAGTGG + Intronic
1146625092 17:34429153-34429175 CTTAGGTATATACCTAGGAGTGG + Intergenic
1146910572 17:36645928-36645950 AATAAATAAATACCAAGGATCGG - Intergenic
1147708223 17:42443237-42443259 CTTAGGTGTATACCTAGGAGTGG + Intergenic
1147893674 17:43736009-43736031 CTTGGGTATATACCTAGGAGTGG + Intergenic
1147912850 17:43866896-43866918 CTTGGGTAAATACCTTGGAGTGG + Intergenic
1148663110 17:49352622-49352644 TGTGGGTAAATACCTAGGAGGGG - Intronic
1148954878 17:51345397-51345419 GAAAGGTGAATACATAGGATGGG + Intergenic
1149259945 17:54868937-54868959 CTTAGGTAACTACCTAGAAGTGG - Intergenic
1149507773 17:57210136-57210158 CTTGGGTAAGTACCTAGGAATGG - Intergenic
1150528561 17:65952614-65952636 CTTTGGTAAATACATAGGAATGG + Intronic
1150935269 17:69628414-69628436 CTTAGGTATATACTTAGGAGTGG - Intergenic
1152602842 17:81273693-81273715 CATAGGTAAAGTTCTAGGACCGG - Intronic
1152869661 17:82745739-82745761 CTCGGGTAAATACCTAGGAGGGG + Intronic
1152966054 18:114903-114925 CATGGGTAAATACCCAGGATTGG + Intergenic
1153001759 18:462179-462201 CTTGGGTATATACCTAGGAGCGG - Intronic
1153045417 18:851502-851524 CTTGGGTAGATACCTAGGAACGG - Intergenic
1153874242 18:9352430-9352452 CTTGAGTAAATACCTAGGAATGG + Intronic
1153892393 18:9530082-9530104 CTTAGAGAAATACCTAGGAGTGG - Intronic
1154407999 18:14113643-14113665 CTTGTGTACATACCTAGGATTGG + Intronic
1154927916 18:20957152-20957174 CATGGGTAAATACCCAGGATTGG - Intronic
1155099630 18:22596529-22596551 CTTGGGTAAATACCTAGGAGTGG + Intergenic
1155457009 18:26028453-26028475 CTTGGGTAAATACCTAGGAGTGG - Intronic
1156210895 18:34941266-34941288 CTTGGGCAAATACCTAGGAATGG - Intergenic
1156265239 18:35482091-35482113 CTTGGGCAAATACCTAGGAGTGG + Intronic
1157324613 18:46659591-46659613 CTTAGGTAAATACCAAGGAGTGG - Intergenic
1157550525 18:48578328-48578350 CTTGGGTATATACCTAGGATTGG + Intronic
1158087128 18:53664624-53664646 CTTGGGTAAATACCTAGGAGTGG - Intergenic
1158096118 18:53773417-53773439 CTTAGGTATATACCTAGGAATGG + Intergenic
1158614479 18:58973633-58973655 CTTGGGTAAATACCCAGGAGCGG - Intronic
1158986633 18:62824224-62824246 CTCGGGTAAATACCTAGGATTGG - Intronic
1159160303 18:64636177-64636199 CTTTGGTAAATACCTAGAAGTGG - Intergenic
1159314714 18:66757242-66757264 CATAGCAAAATACCTGAGATTGG - Intergenic
1159654462 18:71015271-71015293 CTTGAGTAAATACCTAGGACTGG + Intergenic
1160137426 18:76284371-76284393 TTTAGGTATATACCTAGGAGTGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161895649 19:7077644-7077666 CTTGGGTATATACCTAGGAGTGG + Intronic
1161921777 19:7271633-7271655 CTTAGGTAGTTACCTAGGAGTGG - Intronic
1162242567 19:9366691-9366713 CTTGGGTATATACCTAGGAGTGG + Intronic
1164045672 19:21537968-21537990 CATAAGAAAATTCATAGGATGGG + Exonic
1164418145 19:28063189-28063211 CAACTGTGAATACCTAGGATAGG + Intergenic
1164928491 19:32151589-32151611 CTTGGGTAAATACCTAGAAGTGG - Intergenic
1165456674 19:35915662-35915684 CTTTGGTAAATACCTAGGAGTGG - Intergenic
1165590262 19:36963206-36963228 CTTGGATAAATACCAAGGATTGG + Intronic
1166016374 19:39982290-39982312 CTTAAGTAAATACCTAGAAGTGG - Intergenic
1166628125 19:44379596-44379618 CTTGGGTAAATACCTAGGAGTGG - Intronic
1166933182 19:46314159-46314181 CTTGGGTAAACAGCTAGGATTGG + Intronic
1166933354 19:46315560-46315582 CTTGGGTAAACAGCTAGGATTGG + Intronic
1166955347 19:46460631-46460653 CTTAGGTAAATACTTAGGAGTGG + Intergenic
1167817590 19:51897693-51897715 CACAGGTAAATCCCTAGAACAGG + Intronic
1168499694 19:56883241-56883263 TTTGGGTAAATACCTAGAATTGG + Intergenic
924984478 2:256727-256749 CTTGGGTAATTACCTAGGATAGG + Intronic
925951552 2:8917720-8917742 CTTGTGTAAATACCTAGGAGAGG - Intronic
925986542 2:9220207-9220229 CTTGGGTATATACCTAGGAGTGG + Intronic
926184805 2:10681098-10681120 CTTTGGTGAATACCTAGGAGTGG - Intronic
926346354 2:11949757-11949779 GTTAGGTAAATATCTAGGAGTGG - Intergenic
926709253 2:15863859-15863881 ATTAGGTAATTACCTAGGAGTGG - Intergenic
926791880 2:16581699-16581721 CTTGGGTAAATACCTAGGAGTGG - Intronic
926996960 2:18746035-18746057 CTTGGGTAAATACCTAGGAGTGG + Intergenic
927000777 2:18792225-18792247 CATAGTTAAATAGCCAGGCTGGG - Intergenic
927120366 2:19954789-19954811 CTTGGGTACATACCTAGGAGTGG - Intronic
927722766 2:25397106-25397128 CATGGATATATACCTAGGAATGG - Intronic
927807060 2:26157348-26157370 TCTGGGTAAATACCTAGGAGTGG - Intergenic
927953430 2:27190191-27190213 CTTAGTTATATACCTAGGAGCGG - Intergenic
928378129 2:30794537-30794559 CTTGGGTAAATTCCTAGGACTGG - Intronic
928601386 2:32907220-32907242 CCTGGGTATATACCTAGGAGTGG - Intergenic
928717695 2:34081505-34081527 CTTAGTTATATACCTAGGAGTGG + Intergenic
928972416 2:37044610-37044632 CTTAGGTAAATACCTAGAAGTGG + Intronic
929576140 2:43053978-43054000 CTTGGGTACATACCTAAGATGGG - Intergenic
929616100 2:43309328-43309350 CTTGGGTAAAAACCTAGGAAAGG - Intronic
929709198 2:44249183-44249205 CTTAGGTAAATACCTAGGCATGG - Intergenic
929743033 2:44624262-44624284 CTTGGGTAAATATCTAGGAATGG + Intronic
929847301 2:45542690-45542712 CTTAGGTAAATAGCTAGGTGTGG - Intronic
929913245 2:46111814-46111836 CTTGGGTATATACCTAGGAGTGG + Intronic
930097203 2:47574020-47574042 CTTGGGTATATACCTAGGAGTGG - Intergenic
930117045 2:47726987-47727009 CTTGGGTAAATACCTAGGAGTGG + Intronic
930147093 2:48018537-48018559 CTTGGGTATATACCTAGGAGTGG + Intergenic
930212357 2:48653979-48654001 TATGTGTAAATACCTAGGAGTGG + Intronic
930613596 2:53570585-53570607 CATAGGTAAATACCTAGGATTGG + Intronic
930630564 2:53749438-53749460 CTTGGGTTAATACTTAGGATTGG - Intronic
930749862 2:54924117-54924139 CTTAGGTAAATATATAGGAGTGG + Intronic
930851848 2:55969696-55969718 CTTGGGTAAATACCTAGAAGTGG - Intergenic
930876507 2:56224454-56224476 CTTAGATAAATACCTAGGAGTGG + Intronic
930923053 2:56781305-56781327 CTTGGATAAATACCTAGGAGTGG - Intergenic
931322624 2:61186060-61186082 CACTGGTGAATATCTAGGATTGG + Intronic
931703810 2:64930121-64930143 TTTGGGTAAATACCTAGGAGTGG + Intergenic
931712161 2:64997798-64997820 CTTGGGTAAATATCTAGGAGTGG + Intronic
931947818 2:67331024-67331046 CTTGGGTAAATACTTAGGAATGG - Intergenic
931981710 2:67700116-67700138 CATAGGTAGAAACCTTGGACTGG - Intergenic
932107813 2:68963286-68963308 CTTTGGTAAATACCTAGAAGTGG - Intergenic
932328670 2:70883354-70883376 CTTGGGTACATACCTAGGAGTGG - Intergenic
932654160 2:73594079-73594101 CTTGGGTATATACCTAGGAGTGG + Intronic
932797620 2:74711017-74711039 CTTAGGTAAATATCTAGGCATGG - Intergenic
932941846 2:76175932-76175954 CTTAGATATATACCTAGGAGTGG - Intergenic
933010361 2:77054550-77054572 CATAGCTAAATAGCTAGGATAGG + Intronic
933046669 2:77546513-77546535 CATAGGTAAACTCCTATCATGGG - Intronic
933870914 2:86564300-86564322 CTTGGGTAAATAGCTAGGAATGG - Intronic
933906065 2:86893981-86894003 CTTGAGTAAATGCCTAGGATTGG + Intergenic
935034056 2:99351458-99351480 CTTAGGTAAATACCTAGGAGTGG + Intronic
935081419 2:99800553-99800575 CTGGGGTAAATACCTAGGAGTGG - Intronic
935152722 2:100452207-100452229 TTTAGGTAAATACCTAAGTTTGG - Intergenic
935263259 2:101373096-101373118 CTTTGGTATATACCTAGGAATGG - Intronic
935441513 2:103103327-103103349 CTTAGGTAAATACCCAGGAATGG - Intergenic
935759552 2:106307849-106307871 CCTAGGTAAATACCTAGAAATGG + Intergenic
935766908 2:106377151-106377173 CTTGAGTAAATGCCTAGGATTGG + Intergenic
935804284 2:106730809-106730831 CAAAGCAAAATACCTAGAATAGG + Intergenic
936366097 2:111857676-111857698 CTTGAGTAAATGCCTAGGATTGG - Intronic
936395842 2:112128805-112128827 GTTAGGTATATACCTAGGAGTGG - Intergenic
937141754 2:119608010-119608032 CTTAGGTACATACCTAGGCGTGG + Intronic
937306978 2:120877869-120877891 CCCAGGTATATACCTAGGAATGG + Intronic
937397009 2:121546275-121546297 TCTAGGTAGATACCTAGGAATGG - Intronic
938055389 2:128210338-128210360 TTTGGGTAAATACCTAGGAGTGG + Intergenic
938184752 2:129220428-129220450 CTTGGGTACATACCTAGGAGTGG - Intergenic
938769936 2:134492850-134492872 CTTGGGTAAATACCTAAGGTTGG + Intronic
938832105 2:135061290-135061312 CTTGAGTAAATACCTAGGATTGG + Intronic
939006332 2:136791884-136791906 CTTGGGTATATACCTAGGATTGG + Intronic
939159043 2:138563760-138563782 CTTAGGTAAAAACCTAAAATTGG - Intronic
939593173 2:144091671-144091693 CTTGGGTAAATACCTAGGAGTGG - Intronic
939678621 2:145103350-145103372 CTTGGGTATATACCTAGGAGTGG - Intergenic
940501437 2:154499186-154499208 CTTAGATAAATATCTAGGAGTGG - Intergenic
940832366 2:158481392-158481414 TCTAGGTATATACCTAGGAGAGG + Intronic
941055916 2:160787939-160787961 TATAAGTAAATACTTAGGAGTGG - Intergenic
941329445 2:164161599-164161621 CTTGGGTAAATACCTAGGGGTGG + Intergenic
941870854 2:170383970-170383992 CATAGGTAAAGCCATAGCATCGG + Intronic
941913407 2:170789258-170789280 CAGAAGTATATATCTAGGATGGG - Intronic
942180400 2:173374859-173374881 CTTTGGTATATACCTAGGAGTGG + Intergenic
942351956 2:175062117-175062139 TTTGGGTAAATACCTAGGATTGG - Intergenic
942819106 2:180089891-180089913 CATAGGAAAATACCACAGATTGG + Intergenic
943068459 2:183113836-183113858 AATAGGTAAAGACCCAGGGTTGG + Intergenic
943116049 2:183671861-183671883 CGTAGGTAAACACATAAGATTGG - Intergenic
943128672 2:183828657-183828679 CTTAGATAAATATCTAGGAGTGG - Intergenic
943505491 2:188751384-188751406 CTTGGGTAAATACCTAGAAGTGG + Intronic
943888295 2:193251731-193251753 CTTGGGTATATACCTAGGAGTGG - Intergenic
944183128 2:196917836-196917858 CTTGGGTAGATACCTAGGAGTGG + Intronic
944753175 2:202732296-202732318 CTTGGGTATATACCTAGGAGAGG - Intronic
946142229 2:217701423-217701445 ACTGGGTAAATACCTAGGAATGG + Intronic
946150890 2:217769242-217769264 CATGGGTAAATACCTAGAAATGG - Intergenic
946199481 2:218063515-218063537 CTTGGGTATATCCCTAGGATGGG - Intronic
946739368 2:222786796-222786818 CTTGGGTATATACCTAGGAACGG - Intergenic
947134089 2:226959753-226959775 GTTAGGTACATACCTAGGAGTGG + Intronic
948118331 2:235510548-235510570 CTTGGGTAGATACCTAGGAGTGG + Intronic
1168783986 20:521544-521566 CTTGAGTAAATACCTAGGAGTGG - Intronic
1168922032 20:1546590-1546612 CTTGAGTAAATACCTAGGAGTGG + Intronic
1168950256 20:1793866-1793888 CTTAGGTAAATACCTAAAAGTGG - Intergenic
1169334758 20:4747052-4747074 CATAGGTCTTTACCTAGGACTGG - Intergenic
1169710334 20:8554244-8554266 TTTGGGTAAATACCTAGGAATGG - Intronic
1169916197 20:10686353-10686375 CTTAGGTAAATATCCAGGATTGG + Intergenic
1171305997 20:24106592-24106614 CTTGGGTAAATACCTGGGAGTGG - Intergenic
1171501727 20:25598964-25598986 CTTTGGTAAATACCTATGAGTGG + Intergenic
1172041410 20:32048975-32048997 CTCGGGTAAATACTTAGGATTGG - Intergenic
1172440503 20:34962295-34962317 CGTGGGTAGATACCTAGGAGTGG + Intergenic
1172785806 20:37467904-37467926 CTTAGGTATATCCCTAGGAGTGG - Intergenic
1172812941 20:37663118-37663140 CTTAGGTGTACACCTAGGATTGG + Intergenic
1172830188 20:37827317-37827339 CTTGGGTAAATATCTAGGAATGG + Intronic
1172894425 20:38290345-38290367 CTTAAGAAAATACCTAGGAATGG - Intronic
1173056158 20:39615348-39615370 CTTATGTAAATACCTAGGAGTGG + Intergenic
1173130659 20:40390069-40390091 CTTGGGTATATACCTAGGAGTGG - Intergenic
1173314173 20:41928813-41928835 CTTGGGTATATACCTAGGAGTGG + Intergenic
1173879017 20:46396773-46396795 CATTGTGAAAGACCTAGGATTGG - Intronic
1173910481 20:46665742-46665764 CTTAGGTACATACCTAGGAGTGG + Intronic
1173989431 20:47289446-47289468 CTTGGGTAAATACCTAGGAGTGG - Intronic
1174262795 20:49309042-49309064 CTTAGGCAGATACCTAGGAGTGG + Intergenic
1174592281 20:51655771-51655793 CTTGGGTATATACCTAGGAGTGG - Intronic
1175091674 20:56509788-56509810 GTTGGGTAGATACCTAGGATTGG - Intronic
1175386756 20:58601230-58601252 CTTGGGTATATACCTAAGATTGG + Intergenic
1175566291 20:59979965-59979987 TGTAGGTAGATACCTAGGAGTGG + Intronic
1175649208 20:60702806-60702828 CTTGGTTAAATACCTAGGAGTGG + Intergenic
1176054624 20:63137679-63137701 CTTGGGTACATACCTAGAATTGG + Intergenic
1176518315 21:7803879-7803901 CTTGGGTAGATACCTAGGAGTGG - Intergenic
1176726823 21:10442914-10442936 CTTGGGTAAATACCTAGGACTGG + Intergenic
1176940571 21:14919373-14919395 CCTGGATAAATACCTAGGAGTGG + Intergenic
1177462180 21:21426923-21426945 AATAGAAAAATATCTAGGATAGG + Intronic
1178198953 21:30380458-30380480 CTTAGGTAAATACCTATGCATGG + Intronic
1178642656 21:34357949-34357971 TCTAGGTAAATACCTAGAAGGGG + Intergenic
1178652343 21:34433892-34433914 CTTGGGTAGATACCTAGGAGTGG - Intergenic
1178928792 21:36798575-36798597 CTTGGGTAAATCCCTAGGAATGG - Intronic
1178955975 21:37022252-37022274 CATAGGTAAATGCATATCATGGG + Intergenic
1179072671 21:38086744-38086766 CTTGGGTAAATAACTAGGATTGG + Intronic
1179639896 21:42740471-42740493 GATAGGTAGATACATAGAATGGG + Intronic
1179768179 21:43590466-43590488 CTTGGGTAAATACCTAGAAGTGG - Intronic
1180121711 21:45755412-45755434 CATAGGTAAATACCTAGGAGTGG + Intronic
1180287568 22:10764164-10764186 CTTGGGTAAATACCTAGGACTGG - Intergenic
1180820377 22:18823056-18823078 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1180845228 22:18977405-18977427 CTTGGGTAAATACCTAGGAGGGG - Intergenic
1180862615 22:19094634-19094656 CTTGGTTAAATACCTAGGAATGG - Intronic
1181206601 22:21257528-21257550 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1181693506 22:24580668-24580690 CTTGGGTAAATACCTAGGAATGG - Intronic
1182061521 22:27401677-27401699 CTTGGGTATATACCTAGGACTGG - Intergenic
1182227038 22:28806779-28806801 CTTAGGTAAATACCTATAAGTGG + Intergenic
1182388423 22:29968094-29968116 CTTAGGTATATACCCAGGAGTGG + Intronic
1182940549 22:34272486-34272508 CATACATACATACCTAGGATTGG - Intergenic
1183144508 22:35977326-35977348 CTTGGGTAAATACCTAAGGTTGG - Intronic
1183373984 22:37451942-37451964 CTTGTGTAAATACCTAGGAGTGG - Intergenic
1183611444 22:38909518-38909540 CTTGGGTATATACCTAGGAGTGG + Intergenic
1183798346 22:40139785-40139807 CTTAGTTATATACCTAGGAGTGG + Intronic
1184062841 22:42094928-42094950 TCAGGGTAAATACCTAGGATTGG - Intergenic
1184191297 22:42896634-42896656 CTTCGGTGAATACCTAGGAATGG + Intronic
1184932198 22:47689761-47689783 CCTAGGTACATGCCTAGGAGTGG + Intergenic
1185201728 22:49510742-49510764 CTTGGGTAAATACCTAGGACTGG + Intronic
1185412274 22:50689361-50689383 CTTAGGTATATACCTAAGAATGG + Intergenic
949350747 3:3122739-3122761 CTCAGGTAAATATCTAGGAGTGG + Intronic
949365758 3:3278849-3278871 CTTGGGTATATACCTAGGAATGG + Intergenic
949718238 3:6958529-6958551 CCTGGGTAAATATCTAGGAGTGG + Intronic
949893451 3:8750883-8750905 CTTGGGTAAATACCTAGGAGTGG + Exonic
949929289 3:9065840-9065862 CTTAGGTAAATACCCAGGCGTGG + Intronic
950680044 3:14578957-14578979 CTTGGCTAAATACCTAGGAGTGG - Intergenic
950727851 3:14929347-14929369 CTTGGGTCATTACCTAGGATTGG + Intronic
951904937 3:27695970-27695992 CTTTGGTAAATACTAAGGATTGG - Intergenic
951956265 3:28257833-28257855 CATAAGTGAATACCTAGGAGTGG + Intronic
951976004 3:28509329-28509351 CTTGGGTATATACCTAGGATTGG + Intronic
952173208 3:30832672-30832694 CATAGGTACACATTTAGGATGGG - Intronic
952246653 3:31601188-31601210 CTTGGGTAAATACCTAGGAGTGG - Intronic
952927400 3:38330520-38330542 CTTGGGTATATACCTAGGAGTGG - Intergenic
953278061 3:41523769-41523791 CTTAGGTATATACCTAGGAGTGG - Intronic
953327978 3:42028906-42028928 TATAAATAAATACCTAGGATTGG + Intronic
953474979 3:43197594-43197616 CTTGGGTAAATACCTAGGAATGG - Intergenic
953499773 3:43421979-43422001 TGCAGGTAAATGCCTAGGATTGG - Intronic
953502628 3:43452680-43452702 CTTGGGTATATACCTAGGAGTGG + Intronic
953582602 3:44170829-44170851 CTTGGGTAGATACCTAGGAGTGG + Intergenic
953616385 3:44494163-44494185 CTTTGGAAAATAACTAGGATTGG + Intergenic
954066126 3:48107809-48107831 CTTGGGTAAATACCTAGGAGTGG - Intergenic
954158335 3:48701051-48701073 CTTAGTTAAACACCTAGGAGTGG - Intronic
954606967 3:51919459-51919481 CTTGGGTAAATACTTAGGACTGG - Intergenic
954641695 3:52103979-52104001 CTTGGGTAAATACGTAGGAGTGG - Intronic
954667162 3:52261894-52261916 CTTGGGTAAATACCTAGGAGTGG - Intronic
954775664 3:53015421-53015443 CTTGGGTATATACCTAGGAGTGG - Intronic
954818709 3:53305664-53305686 CTAGGGTAAATACCTAGGAGTGG + Intronic
954953546 3:54496153-54496175 CTTAGGTAAATAGCTAGAAGTGG + Intronic
955284135 3:57622571-57622593 CTTGGGTAAATACCTAGGAGTGG - Intergenic
956130655 3:66050661-66050683 CATATATATATACCTAGGAGTGG - Intergenic
956759415 3:72425659-72425681 CTTGAGTAAATACCTAGGAGTGG - Intronic
956990854 3:74762945-74762967 CTTGTGTAAATACCTAGGAATGG - Intergenic
958013209 3:87907037-87907059 CCTGGGTAGATACCTAGGAGTGG + Intergenic
958942314 3:100330124-100330146 CTAGGGTAAATACCTAGGAGAGG - Intergenic
958947118 3:100375875-100375897 CTTGGGTATATACCTAGGAGTGG + Intronic
959175621 3:102905648-102905670 CTCAGGTAAATACCTAGGAATGG + Intergenic
959260610 3:104074925-104074947 CTTAGGTAAATACCTAAGGGTGG - Intergenic
959373592 3:105560064-105560086 CTTGGGTAAAAACCTAGGAGTGG + Intronic
961064543 3:123863838-123863860 CTTGGGTAAATATCTAGGAGTGG - Intronic
961065744 3:123875106-123875128 CTTGGGTAAATATCTAGGATTGG - Intronic
961254158 3:125532724-125532746 CTTGGGTAAATACCCAGGAGTGG - Intronic
961265765 3:125641191-125641213 CTTAGGTATACACCTAGGAGTGG - Intergenic
961513254 3:127417195-127417217 CTTAGGTAAATACCTGGGAATGG - Intergenic
962004885 3:131338482-131338504 CTTGGATAAATACCTAGGAGTGG - Intronic
962401223 3:135060528-135060550 GTTTGGTATATACCTAGGATTGG + Intronic
962571599 3:136719038-136719060 CTTTGGCAGATACCTAGGATTGG - Intronic
962595094 3:136934243-136934265 CATAGGTAAATACATGTCATGGG + Intronic
962644837 3:137427732-137427754 CTTGGGTAAATACCTAGGAGTGG - Intergenic
962922403 3:139962895-139962917 CATGGGTAAATACCTAGGAATGG + Intronic
963053843 3:141166577-141166599 CTTGGGTAAATACCTAGGAGTGG + Intergenic
963075335 3:141341293-141341315 CTTGGGTATATACCTAGGAGTGG - Intronic
963151957 3:142054132-142054154 CTAAGGTAAATACCTAGAAGTGG - Intronic
963167370 3:142219187-142219209 CTAGGGTAAATACCTAGGAGTGG - Intronic
963361834 3:144283660-144283682 TTTAGGTAAATATCTAGGAGTGG - Intergenic
963610949 3:147467669-147467691 TTTAGGTATATACCTAGGAATGG + Intronic
964210650 3:154223343-154223365 CTTGGGTATATACCTAGGAGTGG - Intronic
964461351 3:156933307-156933329 TTTGGGTAAATACCTAGGAGTGG + Intronic
964795290 3:160490243-160490265 CCTGAGTAAATACCTAGGAGTGG + Intergenic
964838809 3:160971164-160971186 CATAGACAAAAACCTAGGCTGGG - Intronic
965651813 3:170942088-170942110 CTTGGGTAAATACCTAAAATTGG - Intergenic
965769151 3:172162489-172162511 CTTGGGTATATACCTAGGAGTGG + Intronic
965930839 3:174041487-174041509 CTTATGTGAATACCTAGGAATGG + Intronic
966467927 3:180252795-180252817 CTTGGGTAAATACCTAGGAGTGG - Intergenic
966707417 3:182931668-182931690 TTTAGGTATATGCCTAGGATTGG - Intergenic
967068349 3:185940379-185940401 CTTAGGTATACACCTAGGAATGG + Intergenic
967800556 3:193654024-193654046 CTTAGGTAAATACCTAAGAGTGG - Intronic
967879599 3:194291931-194291953 CTTGGGTAAGTACCTAGGAGTGG - Intergenic
968092204 3:195906311-195906333 CTTAGGTAAATCCCTAGGACCGG - Intronic
968475178 4:802042-802064 CTTGGGTAAACACCTAGGAGTGG - Intronic
968601207 4:1510408-1510430 CCTGGGTAAATGCCTAGGAGTGG + Intergenic
969082450 4:4629383-4629405 CTTGGGTATATACCTAGGAGTGG + Intergenic
969126587 4:4953093-4953115 TATGGTTAAATACCTAGGAGTGG + Intergenic
969163941 4:5288241-5288263 CTTAGGTATATATCTAGGAGTGG + Intronic
969537238 4:7763940-7763962 GATAGGTGAATACCTAGCAGTGG - Intronic
969544284 4:7814408-7814430 CTCGGGTAAATACCTAGGAGTGG - Intronic
969553625 4:7890907-7890929 CTTAGGTAAATAGCCAGGAGTGG - Intronic
970305872 4:14732211-14732233 GTTAGGTAAATACCTAGGAGTGG + Intergenic
970398307 4:15693841-15693863 CTTTGGTAAATACCTAGGAATGG + Intronic
970468357 4:16350397-16350419 CATAGCAAAAGACCTAAGATGGG - Intergenic
970544170 4:17109975-17109997 CTTGGGTAAATACCTAGGAGTGG + Intergenic
971432733 4:26585145-26585167 CTTGGATAAATACCTAGGATTGG + Intronic
971981514 4:33757407-33757429 CTAGGGTAAATACCTAGGAATGG - Intergenic
972318136 4:37946844-37946866 CTTGGGTAAATACCAAGGAAAGG - Intronic
972412787 4:38809959-38809981 CTTGGGTATATACCTAGGAGTGG + Intronic
973596534 4:52496657-52496679 TCTGGGTAAATACCTAGGAGAGG - Intergenic
973702291 4:53549109-53549131 CATAGGTAAATACATGTCATGGG - Intronic
973805384 4:54520900-54520922 CTTGGGTAAATACCTAGGAGAGG - Intergenic
974138041 4:57844601-57844623 CAGGGGTAAATACCTAAAATTGG - Intergenic
974292876 4:59956497-59956519 GTTAGGTACATACCTAGGAGTGG - Intergenic
974491939 4:62575472-62575494 CTTGGGTAAATACCTAGTAATGG + Intergenic
975350241 4:73338278-73338300 CTTGGGTATATACCTAGGAGTGG + Intergenic
975461013 4:74652823-74652845 CTTTGGAAAATACTTAGGATTGG + Intergenic
975661451 4:76692503-76692525 CTTGGGTAAATACCTAGGCGTGG - Intronic
975672527 4:76796031-76796053 CATGAGTAAATACCTGGGATTGG - Intergenic
975777083 4:77799028-77799050 CTTGGGTAAATATCTAGGAGTGG - Intronic
975856963 4:78634648-78634670 CTTGGGTAAATACCCAGGAGTGG - Intergenic
976284411 4:83357380-83357402 CAAGGGTAAATAACTAGGAGTGG + Intergenic
976852580 4:89565198-89565220 CTTAAGTAAATATCTAGGAGTGG + Intergenic
977077384 4:92472431-92472453 TTTGGGTAAATACCTAGGAATGG + Intronic
977158191 4:93600703-93600725 TTTAGGTAAATACCTGAGATTGG - Intronic
977234572 4:94492874-94492896 CTTAGGTATAGACCTAGGAGAGG + Intronic
977259366 4:94780521-94780543 CCTGGGTATATACCTAGGAGTGG + Intronic
978123150 4:105105793-105105815 CATGGGTACATACCAAGGAATGG - Intergenic
978883641 4:113740143-113740165 CTTGGGTATATACCTAGGAATGG - Intronic
979166638 4:117541033-117541055 TTTAGGTAAATACCTAAGAGTGG + Intergenic
979553711 4:122021056-122021078 TTTAGGTAAATACCCAGGAGTGG - Intergenic
979686705 4:123518155-123518177 CTTGGGTATATACCTAGGAGTGG + Intergenic
980203306 4:129684405-129684427 CATAGGTAAATACTATGGAAGGG - Intergenic
980218700 4:129885238-129885260 ATTAGGTAAATACCTAAGAATGG - Intergenic
980411112 4:132420298-132420320 TATGGGTAAATACTTAGGAGTGG + Intergenic
980862417 4:138515527-138515549 CTTGGGTAAATATCTAGGAGTGG + Intergenic
980984041 4:139678241-139678263 CTTAGGGAAATACCTATGAATGG + Intronic
981283387 4:142987121-142987143 CATAGGTAAACACCTGTCATGGG + Intergenic
981542828 4:145863387-145863409 CTTGGGTATATACCTAGGAATGG - Intronic
981890986 4:149736827-149736849 CTCTGGTAAATACCTAGGATTGG - Intergenic
982020377 4:151197135-151197157 CCTAGGTAGATACCCAGGAGTGG - Intronic
982139121 4:152300842-152300864 CTTGGGTATATACCTAGGAGTGG - Intergenic
982195247 4:152905193-152905215 CTTAGGCAAATACCTAGGAGTGG + Intronic
982223540 4:153145089-153145111 CTTAGGTAGATACCTAGGAGTGG + Intergenic
982328491 4:154155586-154155608 CTTAGGTGAATAGCTAGGAGTGG + Intergenic
982672006 4:158332221-158332243 CTTAAGTAAATACCCAGGAGTGG + Intronic
983080870 4:163383621-163383643 CAAATGTAAATACCTATGAGAGG - Intergenic
983251793 4:165354064-165354086 CTTGGGTATATACCTAGGAGTGG - Intergenic
983372589 4:166880066-166880088 CATAAATAAATACCTGAGATTGG - Intronic
984007028 4:174324392-174324414 CTTGGGTAAATGCCTAGGAGTGG + Intronic
984313632 4:178097679-178097701 CTTAGGTAAATACCTAGTAATGG - Intergenic
984665543 4:182424089-182424111 TATAGGTAAAAACCTAAGAATGG + Intronic
985056620 4:186041377-186041399 CTTAGGTAAACACCTAGGACTGG - Intergenic
985138807 4:186817260-186817282 CTTGGGTAAATATCTAGGAGAGG + Intergenic
985241590 4:187936457-187936479 CTTGGGTAGATACCTAGGAGTGG - Intergenic
985352469 4:189079856-189079878 CTTGGGTAAATTCCTAGGAGTGG - Intergenic
986356110 5:6928054-6928076 CTTAGGTGAATACCTAGAAGTGG + Intergenic
987216192 5:15739878-15739900 CTTAGGTATATACCTAGGAGTGG + Intronic
987658625 5:20842173-20842195 CTTGAGTAAATACCTAGGAGTGG + Intergenic
987685775 5:21198998-21199020 CACAAGGAAATACCTGGGATTGG + Intergenic
988515651 5:31902088-31902110 CATGGGTATATACCTAAGAGTGG + Intronic
988711745 5:33785804-33785826 CTTAAGTAAATATTTAGGATTGG - Intronic
988765059 5:34363761-34363783 CTTGAGTAAATACCTAGGAGTGG - Intergenic
989154596 5:38332331-38332353 CATAGGTAAATACATGCCATGGG + Intronic
989200146 5:38755176-38755198 CTTAAGTAAATACCTAGGAGTGG + Intergenic
989371327 5:40711523-40711545 CTTATGTAAATACCTAGGGATGG - Intergenic
989560814 5:42848668-42848690 CTTGGGTAAATACCTAGGAGTGG - Intronic
990109271 5:52304012-52304034 CTAAGGTAAATACCTAGAAGTGG - Intergenic
990543154 5:56794624-56794646 CATGGGTGTATACCTAGGAGTGG + Intergenic
991375353 5:65959985-65960007 CTTGGGCAAATACCTAGGAGTGG - Intronic
991379868 5:66008947-66008969 CTTGGGTAAATACCTAAGACTGG - Intronic
992191970 5:74301519-74301541 CTTGGATAAATACCTAGGAATGG - Intergenic
992605277 5:78449107-78449129 CTTAGGTAAATACCTACAAGTGG - Intronic
993444853 5:87998883-87998905 CTTAGGTAAATATCTAGGAGTGG - Intergenic
993498686 5:88638892-88638914 CCTGGGTAAATACCTAGGAGTGG - Intergenic
993586757 5:89740657-89740679 CTTGGGTAAATACCTAGAAATGG + Intergenic
994121299 5:96116452-96116474 CTTGGGTAAATACCTAGAAGTGG + Intergenic
994477836 5:100292562-100292584 CTTAGGTAATTACCTAGTAGTGG + Intergenic
994545425 5:101161218-101161240 CATAGGTAAATGCATATCATGGG + Intergenic
995064847 5:107849221-107849243 CTTGGGTAGATACCTAGGACTGG + Intergenic
995179405 5:109216606-109216628 CTTGGGTAAATACCTAGGAGAGG - Intergenic
995316357 5:110778949-110778971 CATAGGTACATGCCTAGTAATGG + Intergenic
996311346 5:122109483-122109505 CTTGGGTAAATACCTAGGAGTGG - Intergenic
996564039 5:124861154-124861176 CTTTGGTATATACCTAGGAATGG - Intergenic
996620098 5:125490016-125490038 CCTGGGTAAATTCCTAGGAGTGG + Intergenic
997154839 5:131544188-131544210 CTTAGGTTAATACCCAGGAGTGG - Intronic
997286608 5:132683993-132684015 CTTGGGTATATACCTAGGATTGG - Intergenic
997515704 5:134488046-134488068 CTTTGGTAAATACCTAGGAATGG + Intergenic
998080505 5:139271362-139271384 CTTGGGTACATACCTAGGACTGG + Intronic
998429462 5:142058510-142058532 CATGAGTAAATACCTAGGAGTGG + Intergenic
998479231 5:142447955-142447977 CTTAGGTAAATACCTAGGAGTGG + Intergenic
998542943 5:143000265-143000287 CTTAGGTAAATACCTAGGAGTGG - Intronic
999115412 5:149159014-149159036 CACAGGGAAATATCTAGGAGAGG - Intronic
999186147 5:149710901-149710923 CTTATATAAATACCTAGGGTGGG + Intergenic
999700383 5:154222469-154222491 CTTGGGTAAATACTTAGGAATGG + Intronic
999704880 5:154263136-154263158 CTTGGGTATATACCTAGGAGTGG - Intronic
999723233 5:154414247-154414269 CTTGGATAAATACCTAGGAGTGG - Intronic
1000259213 5:159569857-159569879 CCTAGGTAAATAACTAGGAGTGG + Intergenic
1000652894 5:163838747-163838769 CTTGGGTAAATACCTGGAATTGG + Intergenic
1000715829 5:164642997-164643019 CATTGGTCAATGCCTAGCATAGG + Intergenic
1000716692 5:164653163-164653185 TGTAGGTAAATTCCTAGGAGTGG + Intergenic
1000847365 5:166298498-166298520 CTTAGGTAAATACCGAGTAGTGG + Intergenic
1001620259 5:173078067-173078089 TTTAGGTATATACCTAGGAGTGG + Intronic
1002156304 5:177283272-177283294 CAAAGGTAAATACCAAGAAAGGG - Intronic
1003372516 6:5542414-5542436 CTTAGGTAAATACTTAGGAATGG + Intronic
1003619644 6:7687931-7687953 CTTGGGTAAACACCTAGGAGTGG - Intergenic
1003865310 6:10357565-10357587 TATAAGTAAATACCTAGGCTGGG + Intergenic
1004023944 6:11800522-11800544 CTTGGGTAAATACCTAGGAGTGG + Intronic
1004626137 6:17378976-17378998 CTCAAGTAAATACCTAGGAGTGG - Intergenic
1004670893 6:17795657-17795679 CCTGGGTAAATACCTATGAGTGG + Intronic
1005130702 6:22504356-22504378 CATAGATACATACCGAGGAAAGG - Intergenic
1005173863 6:23021783-23021805 CTTGGGTACATACCTAGGAATGG - Intergenic
1005817573 6:29568275-29568297 TTTGGGTAAATACCTAGAATTGG - Intronic
1005872937 6:29989625-29989647 CTTGAGTAAATACCTAGGAGTGG - Intergenic
1006299680 6:33186904-33186926 CCTAGGTAAAACCCTAAGATGGG + Intronic
1006739651 6:36298344-36298366 CTTGGGTAAATACCTAGAAATGG + Intronic
1006841494 6:37030947-37030969 CTTAGGTAAATACCTAAAATTGG + Intergenic
1007283839 6:40733073-40733095 CTTGGGTAAATACCCAGGAACGG - Intergenic
1007370066 6:41420929-41420951 CACAGGTCAATACCTAGTAAAGG - Intergenic
1007634689 6:43291947-43291969 CTTGGGTATATACCTAGGAGTGG + Intergenic
1007733038 6:43962645-43962667 CTTGGGTATATACCTAGGAGTGG - Intergenic
1007921385 6:45612811-45612833 CTTAGGTAAATACCTACAAGTGG + Intronic
1008243610 6:49143862-49143884 CATAGGTAAATATCAAGGACAGG - Intergenic
1008706313 6:54164963-54164985 CTTGGGTAAATACTTAGGAGTGG + Intronic
1010784857 6:79989104-79989126 CTTGAGTAAATACCTAGGAGTGG - Intergenic
1011001742 6:82597352-82597374 CTTGGGTAAATACCTAGAAGTGG - Intergenic
1011468574 6:87684860-87684882 CTTGGATAAATACCTAGGAGTGG + Intronic
1011566304 6:88676886-88676908 CTTGGGTAAATATCTAGGAGGGG - Intronic
1012558508 6:100547779-100547801 CTTGGGTAAATCCCTAGGAATGG - Intronic
1013347941 6:109280243-109280265 CTTGGTTAAATACCTAGGAGAGG - Intergenic
1013451955 6:110290721-110290743 CTTGGGTAAATATCTAGGAATGG + Intronic
1013946005 6:115723050-115723072 TCTGGGTAGATACCTAGGATTGG + Intergenic
1014297339 6:119636094-119636116 CTTAGGTAAATACCTAGCATTGG - Intergenic
1014672638 6:124325382-124325404 CTTGGGTAAATACCTAGAAGTGG - Intronic
1014693127 6:124586680-124586702 CTTAGGAAAATATCTAGGAGTGG - Intronic
1014720270 6:124908773-124908795 CTTGGGTATATACCTAGGAGTGG + Intergenic
1015749170 6:136543096-136543118 TCTGGGTAAATACCTAGGAGTGG - Intronic
1015800453 6:137056441-137056463 CTTTGTTAGATACCTAGGATTGG - Intergenic
1016203308 6:141440386-141440408 CTTGGGTAAATGCCTAGGATTGG + Intergenic
1016864643 6:148753678-148753700 TATGGGTATATACCTAGGAGTGG + Intronic
1018747937 6:166776914-166776936 CTTGGGTACATACCTAGGAGGGG + Intronic
1019166790 6:170102584-170102606 CTTGGGTAAATACCCAGGATTGG - Intergenic
1020407471 7:7854027-7854049 CATAAGGAAATACCTGAGATTGG + Intronic
1020425408 7:8060824-8060846 CTTGGGTATATACCTAGGGTTGG + Intronic
1020851220 7:13355792-13355814 CCTAGGTAAATACCTAGGAGAGG - Intergenic
1021127953 7:16875610-16875632 CTTGGGTATATACCTAGGAGTGG + Intronic
1021531767 7:21654587-21654609 TGTAGGTATATACCTAGGAGAGG + Intronic
1021607503 7:22423256-22423278 CTTAAGTAGATACCTAGGAGTGG - Intronic
1021671004 7:23034878-23034900 CATAGGTAGAAACCTAAAATTGG + Intergenic
1021725304 7:23542795-23542817 CTTCGGTATATACCTAGGAATGG - Intergenic
1021743163 7:23709182-23709204 CATGGGTTAGTACCTAGGAGTGG - Intergenic
1021781116 7:24107157-24107179 CTTTGGTATATACCTAGGAGTGG + Intergenic
1021785568 7:24148535-24148557 CTTGGGCAAATACCTAGGAATGG + Intergenic
1022367677 7:29741007-29741029 CTTAGGGAAACACCTAGGAGTGG - Intergenic
1022402915 7:30057830-30057852 CTTGAGTAAATACCTAGGACTGG + Intronic
1022928504 7:35082860-35082882 CTTAGGGAAACACCTAGGAGTGG + Intergenic
1023180606 7:37479207-37479229 CTTGGGTATATACCTAGGAGTGG + Intergenic
1023364426 7:39449585-39449607 CTAATGTAAATACCTAGGAGTGG - Intronic
1023664604 7:42509921-42509943 CTTTGGTAAATACTTAGGAGTGG - Intergenic
1024123404 7:46267585-46267607 CATAGCAAAATACCAAAGATTGG - Intergenic
1024627210 7:51218137-51218159 CCTCGGAATATACCTAGGATTGG - Intronic
1025823463 7:64992690-64992712 CAGAGGGAAATACCTTGGTTTGG + Exonic
1026413465 7:70153059-70153081 CTTGGGTAAAAACCCAGGATTGG - Intronic
1026423090 7:70260685-70260707 CTTGGGTAAATACCTAGGAGTGG - Intronic
1027025643 7:74850273-74850295 CATAGGTGTATACCAAGGACTGG - Intronic
1027062121 7:75093846-75093868 CATAGGTGTATACCAAGGACTGG + Intronic
1027392153 7:77715312-77715334 CTTGGGTAAATACCTAGCAGTGG + Intronic
1027492307 7:78844293-78844315 CTTGGGTATATACCTAGGAGTGG - Intronic
1027522298 7:79224457-79224479 CTTGGGTAAATATCTAGGATTGG - Intronic
1027547238 7:79542947-79542969 CCCCGGTAAATACCTAGGAAAGG + Intergenic
1027611271 7:80364030-80364052 CTTGGGTAAATATCTAGGAGTGG + Intergenic
1027887344 7:83926047-83926069 CTTAGGTATATACCTAGAAAGGG + Intergenic
1028259876 7:88649881-88649903 CATGGGTCATTACCAAGGATAGG + Intergenic
1028847468 7:95498027-95498049 CTTATATAAATACCTAGGAGTGG + Intronic
1028894132 7:96022008-96022030 CTTGGGTATATACCTAGGAGTGG + Intronic
1029163996 7:98573192-98573214 CTCAGGTAAATACCTAGGAGTGG + Intergenic
1029802623 7:102965269-102965291 CATGGTTAAATGGCTAGGATGGG - Intronic
1029824616 7:103176534-103176556 CTTAGGGAAACACCTAGGAGTGG + Intergenic
1030112717 7:106040327-106040349 CCTAGGTATATACCTAGGAATGG + Intergenic
1030182909 7:106729435-106729457 CTTGGGTATATACCTAGGAGGGG - Intergenic
1030209683 7:106984047-106984069 CATATGTATATACCCAGGCTGGG + Intergenic
1030257244 7:107523922-107523944 CTTGGATAAATACCTAGGATTGG - Intronic
1030522367 7:110613928-110613950 CTTAGGTAAATACCTAGGAGGGG - Intergenic
1030704042 7:112672788-112672810 CTTGGGTAAATACTTAGGAGTGG + Intergenic
1031258576 7:119487993-119488015 CTTTGGTAAATACCTAAGAGTGG - Intergenic
1031376843 7:121036640-121036662 CATGGGTAGATACCTAGTAGTGG + Intronic
1031495620 7:122444311-122444333 CTTGGGAAAATACCTAGGAATGG + Intronic
1031501090 7:122517403-122517425 CCTGGGTAAATACCTAGGAGTGG + Intronic
1031624662 7:123978141-123978163 CCTCGGTAAATGCCTAGGAGTGG - Intergenic
1031664647 7:124469045-124469067 TTTAGGTAAATACCTAGGAGTGG + Intergenic
1032142609 7:129346771-129346793 TTTAGGTAAATACCAAGGAATGG - Intronic
1032385864 7:131523030-131523052 CTTGGGTACATACCTAGGATTGG + Intronic
1032611101 7:133415279-133415301 CTTGGGTATATACCTAGGAGTGG + Intronic
1032943078 7:136817967-136817989 CTTGGGTATATACCTAGGAGTGG - Intergenic
1033318911 7:140322090-140322112 CCTGGGTAAATACCTAGTTTTGG - Intronic
1033328080 7:140395754-140395776 CAGAGGTATATACCAAGGATGGG + Intronic
1033765420 7:144484463-144484485 CTTAGGTGTATACCTAGGAGTGG - Intronic
1033786547 7:144738116-144738138 CTTGGGTACATACCTAGGAGTGG + Intronic
1033993457 7:147316106-147316128 CTTGGGTATATACCTAGGAGTGG + Intronic
1034388585 7:150763587-150763609 CTTAGGTCAATACCTTGGAGTGG - Intergenic
1034389388 7:150772483-150772505 CTTAGGAATATACCTAGGAGTGG - Intergenic
1034603289 7:152285041-152285063 CTTGGGTAAATACCTAGGACTGG - Intronic
1034647319 7:152659783-152659805 TATCGGATAATACCTAGGATAGG - Intronic
1035176094 7:157052111-157052133 CCTGGGTATATACCTAGGAGTGG - Intergenic
1035594524 8:845167-845189 CTTGGGTATATACCTAGGAGTGG + Intergenic
1036076087 8:5502175-5502197 CTTAGTTAAATAACTAGGAATGG + Intergenic
1036399464 8:8395260-8395282 CTTAGGTAGATACCCAGGAGTGG - Intergenic
1036619233 8:10412967-10412989 CGTAGGTAAAAATCTAGGACTGG - Intronic
1036718410 8:11148666-11148688 CCTCGATAAATACCTAGGAGTGG - Intronic
1036986784 8:13541302-13541324 CTTAAGTAAATACCTAGAAATGG + Intergenic
1037357872 8:18041853-18041875 CATGAGTAAATACCTAGGATTGG + Intergenic
1037370324 8:18170412-18170434 CAAAGGTAAACTCCTAGGTTAGG - Intergenic
1037650262 8:20830750-20830772 CTTGGCTAAATACCTAGGAGTGG - Intergenic
1038116118 8:24557492-24557514 CATTGATAAATACCTAGAAAGGG - Intergenic
1038457189 8:27683636-27683658 CTTGGGCAAATACCTAGGAGTGG - Intergenic
1038582081 8:28756594-28756616 CTTGGGTAAATACCTAGGAGTGG + Intergenic
1038652304 8:29416442-29416464 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1038685672 8:29715555-29715577 CTTAGGTAAATATCTAAGAACGG + Intergenic
1038887904 8:31685998-31686020 CTTAGGTGTATACCTAGGAGTGG + Intronic
1039052222 8:33505444-33505466 AATAGGTAACTAACTAGGTTTGG - Intronic
1039345436 8:36699041-36699063 ATTGGGTAAATACCTAGGAATGG + Intergenic
1039592346 8:38759620-38759642 CCTAGGCAAAGACCAAGGATGGG - Intronic
1039675793 8:39665447-39665469 CTTAGCTAGATACCTAGGAGAGG + Intronic
1039875784 8:41584311-41584333 CTTGGGTAAATACCTAGGAGTGG - Intronic
1039889705 8:41676101-41676123 CTTGGGTAAATAGCTAGGAATGG + Intronic
1039924544 8:41917072-41917094 CTTGGGTAAATACCCAGGAGTGG + Intergenic
1040053439 8:43037109-43037131 CTTGGGTAAACACCTAGGAGTGG + Intronic
1040394398 8:46982673-46982695 CTTAGGGAAATACCTAAAATTGG + Intergenic
1041002695 8:53467564-53467586 CATAAGAATATACCTTGGATGGG - Intergenic
1042006698 8:64188176-64188198 CTTGGGTACATACCTAGGAGTGG - Intergenic
1042032211 8:64488861-64488883 CATAGACAAATACCTAGGGCTGG + Intergenic
1042587979 8:70363434-70363456 CATAGGTAAATATCTAGGAGTGG - Intronic
1043129643 8:76445330-76445352 CACAAGTAAATAACTAGGAAAGG - Intergenic
1044133402 8:88555370-88555392 TGTGGGTATATACCTAGGATTGG + Intergenic
1044490313 8:92805798-92805820 CATAGTGAAAAACCTAGAATAGG - Intergenic
1044766386 8:95579770-95579792 CTTAGGCAAATGCCTAGGAATGG - Intergenic
1044854431 8:96459956-96459978 CTAGGGTAAATACCTAGGAGTGG + Intergenic
1045105856 8:98892003-98892025 CAAAGGTAAATATCTGGGGTAGG + Intronic
1045665451 8:104479548-104479570 CTTGGGTATATACCTAGGAGTGG + Intergenic
1047079126 8:121440658-121440680 CTTTAGTAAATACCTAGGAATGG + Intergenic
1048536301 8:135298892-135298914 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1048719433 8:137306490-137306512 CATCTGTAAATACCCAGGAATGG - Intergenic
1048949215 8:139480124-139480146 CATGGGTATGTACCTAGGAGTGG - Intergenic
1048960700 8:139574354-139574376 CCTAGGTTTATACCTAGGAATGG + Intergenic
1049304302 8:141892157-141892179 CTTGGGAAAATACCTAGGAGTGG - Intergenic
1049677249 8:143896225-143896247 TTTAGGTATATACCTAGGAATGG + Intergenic
1049970345 9:816664-816686 CTTGGATAGATACCTAGGATTGG - Intergenic
1050028514 9:1360847-1360869 ACTAAGTAAATACCTAGGAAAGG + Intergenic
1050046173 9:1548028-1548050 CATGGGTAAATACCTAAGAGTGG - Intergenic
1050219960 9:3376325-3376347 CATGGGTAAATACCTAGGAGTGG - Intronic
1050655080 9:7818993-7819015 CTTAGGTAAACACCTAGGAGTGG - Intronic
1050676318 9:8058466-8058488 TATAGGTAAATACCCAGTAGTGG - Intergenic
1050841272 9:10152040-10152062 CATTCATAAATACCTAGGGTTGG + Intronic
1050866823 9:10511269-10511291 CTCAGATAAATACCTAGGAGTGG + Intronic
1051343835 9:16134797-16134819 TTTAGGTAAATACCTAGGAGTGG - Intergenic
1051514683 9:17915566-17915588 GTTAGGTAAATACCTAGGAATGG + Intergenic
1051810452 9:21042947-21042969 CTTAGGTAAATATTTAGGAATGG + Intergenic
1052737372 9:32356139-32356161 GTTAGGTAAATACCTAGAAGTGG + Intergenic
1053332510 9:37227576-37227598 CTTGGGTAAATACCTGGGAATGG - Intronic
1055288829 9:74761249-74761271 CCTTGGTAAATACTTAGGAACGG - Intronic
1055900515 9:81229094-81229116 CATAGGTAGAAATCTAGGAGTGG + Intergenic
1056058634 9:82859182-82859204 CTTGGGTAAATACTTAGGAGTGG - Intergenic
1056871487 9:90285466-90285488 CTTAGGGATATACCTAGGAGTGG - Intergenic
1057358684 9:94353733-94353755 CTAAGGTAAATACCTAGGAGTGG - Intergenic
1057456911 9:95221977-95221999 CTTGGATAAATGCCTAGGATTGG - Intronic
1057603279 9:96478480-96478502 CCTGGGTAAATACCTAGGAGTGG + Intronic
1057649067 9:96903877-96903899 CTAAGGTAAATACCTAGGAGTGG + Intronic
1057756694 9:97844422-97844444 CTTGGGTAAATACCTAGGAGAGG - Intergenic
1057989456 9:99752741-99752763 CTTGGGTAAATACGTAGGAGTGG + Intergenic
1058079137 9:100683528-100683550 CCTGGGGAAATACCTAGGAGTGG - Intergenic
1058569875 9:106329400-106329422 CTTGGGTAAATACCTAGGAGTGG - Intergenic
1058576193 9:106405055-106405077 CTTAGGTAAATAACTAAGGTTGG - Intergenic
1058853897 9:109040941-109040963 CGTCTGTAAATACCTAGGAGTGG + Intronic
1059106811 9:111519209-111519231 CATGAGTAAATACCTAGAAGTGG + Intergenic
1059217332 9:112576845-112576867 CTTGGGTAACTACCTAGGAGTGG + Intronic
1059477991 9:114563456-114563478 GCTATGTAAATACTTAGGATTGG + Intergenic
1060045978 9:120341122-120341144 CTTTGGTATATACCTAGGAATGG - Intergenic
1060082720 9:120666635-120666657 CTCAGATAAATACCTAGGAGTGG - Intronic
1060095033 9:120781233-120781255 AATAGGTATATACCAGGGATTGG - Intronic
1060370328 9:123063410-123063432 CTTTGGTAAATACCTAGGAATGG + Intronic
1060774159 9:126357353-126357375 TATGGATAAATACCTAGGAGTGG + Intronic
1061991299 9:134160172-134160194 CACAGGTATATACCTAAGAGTGG - Intergenic
1062204378 9:135327739-135327761 CTTAGGTACATACCTAGGCATGG - Intergenic
1186399931 X:9248342-9248364 CTTAGGTAAATACCTAGGAGTGG - Intergenic
1186572797 X:10733936-10733958 TTTAGGTAAATACTTAGGAGTGG - Intronic
1186653564 X:11588407-11588429 CTTGGGTATATACCTAGGAATGG - Intronic
1187124548 X:16442342-16442364 CTTAGGTAGATACTTAGGAGTGG - Intergenic
1187178961 X:16924890-16924912 CTTGGGTATATACCTAGGAGTGG + Intergenic
1187436256 X:19272666-19272688 CTTGGGCAAATACCTAGGAGTGG - Intergenic
1187630746 X:21168517-21168539 CTTTGGTATATACCTAGGAGTGG - Intergenic
1187930349 X:24287890-24287912 CCTGGGTATATACCTAGGAGTGG + Intergenic
1188362270 X:29270249-29270271 CTTAGTCAAATACCTAGGAATGG + Intronic
1188454684 X:30350355-30350377 CTGGGGTAAATACCTAGGATGGG - Intergenic
1188462269 X:30442336-30442358 CATCAGTATATACCTAGGAGTGG + Intergenic
1188488833 X:30714187-30714209 CATAGGTTTATACCTAAAATAGG - Intronic
1188767345 X:34110882-34110904 CTTGGGTAAATAACTAGGAGTGG + Intergenic
1189136952 X:38560574-38560596 CTTGGGTAAATACCCAGGAATGG + Intronic
1189304533 X:39976841-39976863 CTTGGGCAAATACCTAGGAGTGG - Intergenic
1189435494 X:40989316-40989338 CTTGGATATATACCTAGGATTGG - Intergenic
1189442718 X:41051669-41051691 TTTGGGTAAATACCTAGGAATGG - Intergenic
1189489631 X:41459887-41459909 CTTGGGCAAATACCTAGGAGTGG + Intronic
1189621097 X:42838817-42838839 CTTGGGTGAATACCTAGGAATGG + Intergenic
1189827014 X:44929641-44929663 TTTGGGTAAATACCTAGGAGTGG + Intronic
1190146595 X:47897076-47897098 CTTGGGTAAATACCTAAGATTGG + Intronic
1190821598 X:53978297-53978319 CTAGGGTAAATACCTAGGAATGG - Intronic
1190895659 X:54615418-54615440 TTTGGGTAAATACCTAGGAGTGG + Intergenic
1191036755 X:56032836-56032858 GATGGGTAAATACCTAAGAGTGG + Intergenic
1191712688 X:64167404-64167426 CCTGGGTGAATACTTAGGATTGG + Intergenic
1192083255 X:68068569-68068591 CTTGGGTATATACCTAGGACTGG - Intronic
1192086979 X:68109522-68109544 CTTAGGTATATACCTAGGAGTGG + Intronic
1192130612 X:68546150-68546172 CTTGGGTAGATACCTAGGAAGGG + Intergenic
1192275476 X:69626294-69626316 CTTAGGTATATGCCTAGGAGTGG - Intronic
1192345893 X:70305101-70305123 CTTGGGTATATACCTAGGAATGG + Intronic
1192354774 X:70391111-70391133 CTTGGGTAAATACCTAAGAGTGG + Intronic
1193149273 X:78107737-78107759 CATGGGTAAACACCTAGGAGTGG + Intronic
1193498681 X:82244600-82244622 CATAATAAAATACCTAAGATTGG + Intergenic
1193987692 X:88266228-88266250 TATAGGTATATACCTAGTAATGG - Intergenic
1194476558 X:94366203-94366225 CATGGGTAAATACTTACGTTTGG + Intergenic
1194702281 X:97128998-97129020 CTTGGGTAAATACCTAGGAGTGG + Intronic
1194806424 X:98334097-98334119 CTTAGATAAATACCTAGAATTGG - Intergenic
1195178752 X:102336591-102336613 CTTATGTAAAGACCTAGGAGTGG + Intergenic
1195180112 X:102350492-102350514 CTTATGTAAAGACCTAGGAGTGG - Intergenic
1195606131 X:106807716-106807738 CATAGGGCAATACCTAGGGAGGG - Intronic
1195655777 X:107330179-107330201 CATAGCAAAATACCAAGGACTGG - Intergenic
1195795292 X:108641214-108641236 CTTGGGAAAATACCTAGGAGTGG - Intronic
1195885370 X:109631985-109632007 CTTGGGTAAATACCTAGGTGTGG + Intronic
1196078313 X:111602136-111602158 CTTGGGTAAATACCTAGAAATGG + Intergenic
1196087753 X:111704339-111704361 CTTAGGTATATACCTAGGAGTGG - Intronic
1196095477 X:111793690-111793712 CTTGGGTATATACCTAGGAGTGG - Intronic
1196169623 X:112573456-112573478 CCTGGGTAAATATCTAGGATAGG - Intergenic
1196221514 X:113116625-113116647 CATTGGTATCTACCTAGGAGTGG - Intergenic
1196336415 X:114541577-114541599 CTTGGGTATATACCTAGGAGTGG - Intergenic
1196646391 X:118122361-118122383 CTTGAGTAAATACCTAGGAGTGG - Intergenic
1196713676 X:118790486-118790508 CTTGGGTAAATACCTGGGAGTGG + Intronic
1196719695 X:118841749-118841771 CTTGGGTATATACCTAGGAGTGG + Intergenic
1197194789 X:123688098-123688120 CTTGGGTAAATACCTAGGCTGGG - Intronic
1197711012 X:129667454-129667476 CTTGGGAAAATACCTAGGAGTGG + Intergenic
1197948666 X:131870719-131870741 CATAGGTAAATATCTAAGTGTGG - Intergenic
1198182325 X:134221783-134221805 CTTGGGTATATACCCAGGATGGG - Intergenic
1198411535 X:136374370-136374392 CTTGGATAAATACCTAGGAATGG + Intronic
1198490984 X:137141367-137141389 CCTTGGTAAATACTTAGGAGGGG + Intergenic
1198769381 X:140112944-140112966 CTTGGGTATATACCTAGGAATGG + Intergenic
1198771140 X:140131303-140131325 CTTGGGTATATACCTAGGAATGG + Intergenic
1199160088 X:144598556-144598578 CTTAGCTAAATACCTAGGTGTGG + Intergenic
1199923764 X:152439594-152439616 GCTAGGTAAATACCTAGAAGGGG - Intronic
1199945209 X:152659856-152659878 CATACATATATACCTATGATAGG + Intergenic
1200305050 X:155016419-155016441 CTTAGTTAAATATCTAGGAGTGG - Intronic
1200351830 X:155504671-155504693 CTAAGGTAAATACCTAGGAGTGG - Intronic
1200362221 X:155620335-155620357 CTTGGGTAAATACTTAGGAGTGG - Intronic
1200760125 Y:7030061-7030083 CTTGGGTAAATATCTAGGAGTGG + Intronic
1200890270 Y:8315795-8315817 GATAGGCAAATACCTACTATTGG - Intergenic
1201315266 Y:12639509-12639531 CACAGGGAAATACCCAGGTTCGG + Intergenic