ID: 930617180

View in Genome Browser
Species Human (GRCh38)
Location 2:53605845-53605867
Sequence TCACATCCATATTCTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930617180_930617182 8 Left 930617180 2:53605845-53605867 CCTTCCAGAGAATATGGATGTGA 0: 1
1: 0
2: 0
3: 11
4: 166
Right 930617182 2:53605876-53605898 GACAGTTATGTTCTCTCACCAGG 0: 1
1: 0
2: 0
3: 15
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930617180 Original CRISPR TCACATCCATATTCTCTGGA AGG (reversed) Intronic
902719319 1:18293476-18293498 TCACGTCCACATTCTCAGCATGG - Intronic
903254989 1:22090986-22091008 TGGCATCCTTATTCTATGGAAGG - Intronic
903966582 1:27094399-27094421 TCATATCCACATTCCCTGGAGGG - Intergenic
906111392 1:43324550-43324572 TCAGATCCACATTCACTGCAGGG + Intergenic
907554544 1:55333210-55333232 TCCCTTCCTTGTTCTCTGGAAGG - Intergenic
908026998 1:59962942-59962964 TCTCATCCATATTCACTCAATGG - Intergenic
912940017 1:114036573-114036595 CCACATCTCTGTTCTCTGGAAGG - Intergenic
915153708 1:153856885-153856907 CCATATCCATAGTATCTGGAGGG - Intronic
915493293 1:156263675-156263697 TCATATCCAAATTCCTTGGAAGG - Intronic
918409735 1:184245865-184245887 TCACATGCATTTTCTCTTGATGG - Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063302712 10:4866248-4866270 CCACATCCACATTCTTTTGACGG + Intergenic
1063510244 10:6637644-6637666 TCCCATCCACATTCTAGGGAAGG + Intergenic
1064269135 10:13849404-13849426 TCAACTCCATATTCTCTGCTTGG + Intronic
1066032210 10:31440108-31440130 TCCCATGCATCTACTCTGGAAGG - Intronic
1066267475 10:33790427-33790449 TGACCTGCATATTCACTGGAGGG + Intergenic
1068811184 10:61257428-61257450 TCCCACCCGTATTCTATGGACGG - Intergenic
1069028671 10:63571975-63571997 TCAGATGCATATTCACTGGCTGG - Intronic
1070543816 10:77437193-77437215 TTACATCCAGAGTTTCTGGAGGG - Intronic
1071096556 10:81981938-81981960 TCACATCCATAATTTCTTTATGG + Intronic
1072319279 10:94233053-94233075 TCAGATCCACTTTCTCTGCATGG + Intronic
1073582415 10:104680751-104680773 TGACTTCCAGGTTCTCTGGAGGG + Intronic
1073767852 10:106703085-106703107 ACACAACCAAATTCTCAGGAAGG + Intronic
1075200222 10:120396088-120396110 GCAGAGCTATATTCTCTGGAAGG - Intergenic
1075766980 10:124900795-124900817 TCACATCCATACTCCAGGGAGGG + Intergenic
1079657663 11:23002634-23002656 TCACCTCCAAATTCTCAAGAAGG + Intergenic
1080774743 11:35375314-35375336 ACACATTCAGCTTCTCTGGAAGG - Intronic
1084090801 11:66878433-66878455 TCACCTCCAGAGCCTCTGGAAGG + Intronic
1085807199 11:79647366-79647388 ACCCATCCCTACTCTCTGGAGGG - Intergenic
1087523084 11:99268722-99268744 TCATATCCATATTTTTTGTAAGG - Intronic
1087655046 11:100912408-100912430 TCAGTTCCAGAATCTCTGGAAGG + Intronic
1089100574 11:115958976-115958998 TCACATCCCCCTTCCCTGGACGG + Intergenic
1091883699 12:4000728-4000750 TAATATCCATATTCTTGGGAGGG + Intergenic
1092228772 12:6765830-6765852 CTCCATCCACATTCTCTGGATGG - Intronic
1095866034 12:46973040-46973062 ACACACACACATTCTCTGGAAGG + Intergenic
1096346179 12:50848822-50848844 TCATATCCATATCCTATGCAAGG - Intronic
1100849985 12:98699479-98699501 TCACTTCCATATCCTCTTGAGGG - Exonic
1103585218 12:121948156-121948178 TCACTTCCATAGTTTCTGCAGGG + Intronic
1104199253 12:126572011-126572033 TGAAGTCCATTTTCTCTGGAAGG - Intergenic
1106375319 13:29181147-29181169 CCACAGCCATATTCTCTCGATGG + Intronic
1108085604 13:46788426-46788448 TCAAATCCATATTCAATGCAGGG + Intronic
1111562885 13:89975212-89975234 TAACTACCATATTGTCTGGATGG + Intergenic
1111876525 13:93904039-93904061 TGTCATCCATATTCTCTGCTTGG - Intronic
1113173822 13:107537588-107537610 TCTCATTCTTATTGTCTGGATGG - Intronic
1113272285 13:108686534-108686556 TCACCTCCATATCCCCTGGCTGG - Intronic
1115104401 14:29743329-29743351 TCACATGCCTTTTCACTGGAAGG + Intronic
1118868949 14:69725768-69725790 TCACATCCATATCCTTAGTATGG - Intergenic
1120615029 14:86693509-86693531 TCACATTCATATTTTCTGAGTGG - Intergenic
1121948403 14:98145836-98145858 TCACAACGCTATTCACTGGAGGG - Intergenic
1123913653 15:24998132-24998154 TCACATGAAAATTCTTTGGAAGG + Intergenic
1130337445 15:82968864-82968886 TCACAGCCAGACTATCTGGAAGG + Intronic
1133004252 16:2869203-2869225 TTACATCCATCTTATCTGTATGG + Intergenic
1135112438 16:19700782-19700804 TAACATCTTTCTTCTCTGGAAGG + Exonic
1138084395 16:54120559-54120581 TCACACCCATATTTTATAGATGG + Exonic
1140107679 16:71975913-71975935 TCTCATCCAGTTTCTCTGAATGG - Intronic
1141897493 16:86967871-86967893 TAACATCCAGATTTTCTGGATGG - Intergenic
1142135584 16:88450557-88450579 TCACATCCAAAGTCACTGGTGGG - Intergenic
1144166705 17:12618626-12618648 ACACATGCATTTTCTCTGTAAGG - Intergenic
1144760151 17:17702528-17702550 TCACCTCCATTTTGTCTGCAAGG - Intronic
1144811921 17:18006031-18006053 TCACAACCATCTGCTCAGGAGGG + Intronic
1148405842 17:47414840-47414862 CCACCTCCATATTATCTGGAAGG - Exonic
1150265833 17:63831947-63831969 TCACTTCCATAATTTCTTGATGG - Exonic
1152140811 17:78535333-78535355 TCACAGCCATCTTCTCAGCATGG + Intronic
1155078135 18:22381201-22381223 TCACATCCATCTTCACAGGGAGG + Intergenic
1155581150 18:27308037-27308059 TTACATCTAAATTCTCTGCAGGG + Intergenic
1155969424 18:32067419-32067441 TCACAGCCATATTCTTGGGTAGG + Intronic
1162966275 19:14157622-14157644 TCACTTCCTCATGCTCTGGAAGG + Intronic
1167344979 19:48939633-48939655 TCACCTCCATGGTCTTTGGAGGG + Exonic
927868210 2:26606524-26606546 TCACATTTTTATTCCCTGGAAGG - Intronic
928140175 2:28721740-28721762 TTGCATTCATATTCTCTGAAAGG - Intergenic
930617180 2:53605845-53605867 TCACATCCATATTCTCTGGAAGG - Intronic
935389610 2:102536576-102536598 TTCCCTCCATACTCTCTGGAAGG + Intergenic
939527730 2:143318367-143318389 TAATATCCATAATCACTGGAAGG - Intronic
940748873 2:157600904-157600926 TCCCACCCATATTCTTTGAAGGG - Intronic
942606078 2:177692568-177692590 TCAAATCCTTATTCACTGCAGGG + Intronic
944909606 2:204296879-204296901 TCACATCTACATTATCTGGCTGG + Intergenic
944993259 2:205262512-205262534 CCACAGCCATATGCTCTGAAAGG - Intronic
945297694 2:208187363-208187385 TCACATCCATCTAGTTTGGATGG - Intronic
945866990 2:215187203-215187225 GCACATACATTTTCTCTGGAAGG - Intergenic
945959451 2:216117043-216117065 TCACTTCCCTGTTCTCTGCATGG + Intronic
1169519775 20:6358314-6358336 ACTCATCCATATTTTCTGGTAGG + Intergenic
1169751255 20:8997060-8997082 TAGCATCCATATTCTTTGCAAGG + Intergenic
1171758252 20:29138930-29138952 TCACTTCCAGATTCTACGGAAGG - Intergenic
1174744295 20:53046222-53046244 TCACATCAGTGTTCTTTGGATGG - Intronic
1174947207 20:55001109-55001131 ACACATCCATATTATAAGGAAGG + Intergenic
1175972244 20:62692393-62692415 TCACAAGCATGTCCTCTGGAGGG - Intergenic
1178270701 21:31186848-31186870 TAAAATGCATATTCCCTGGAAGG + Intronic
1178353493 21:31891060-31891082 TCACTTCCATTTTGTCTGGTTGG - Intronic
1179514599 21:41897984-41898006 ACACTGCCATATTCCCTGGAGGG + Intronic
1179789353 21:43747556-43747578 TCCCATGCTTGTTCTCTGGAAGG + Intronic
1182473487 22:30562714-30562736 CCTCATCCACATTCTCTGCACGG - Intronic
1184801686 22:46764575-46764597 TCACATCCATAGTTTCCAGATGG - Intronic
951293769 3:20907056-20907078 TAAAATCCATATGCACTGGAAGG + Intergenic
951397903 3:22192624-22192646 TGACATCAATAATCTCTTGAAGG - Intronic
954172776 3:48818490-48818512 TCACACCCATAATCTTTGGGAGG + Intronic
954810690 3:53245479-53245501 TGACATCCATTATCTCTTGAAGG - Intronic
956340614 3:68219624-68219646 TCAGAGACATGTTCTCTGGAAGG - Intronic
956794152 3:72702941-72702963 TCCCATCCTTATGCACTGGATGG - Intergenic
958755127 3:98243263-98243285 TCACATCCAAAATCTGTAGATGG + Intergenic
959757628 3:109917770-109917792 TCACATACATCTTCACTGGCAGG - Intergenic
961853766 3:129848770-129848792 TCACTCCCATATTCTCATGAAGG + Intronic
965920332 3:173905618-173905640 TCACATCCATTGTCCCTGGCAGG - Intronic
969589825 4:8115388-8115410 TGACATCCATCTCCTCTGTAGGG + Intronic
971221896 4:24716631-24716653 GCCCATCCAGAATCTCTGGATGG - Intergenic
972089265 4:35259236-35259258 TCTCATCCATATACTTAGGATGG - Intergenic
972558659 4:40205793-40205815 TCACATTCTTTTTCTCCGGAGGG - Intronic
973809734 4:54558076-54558098 GCACATCTCTAATCTCTGGAAGG - Intergenic
974159215 4:58115834-58115856 CATCATCCATATTCTCTAGATGG + Intergenic
974812206 4:66959099-66959121 TCACATCCAATTTTTTTGGAAGG - Intergenic
976598103 4:86913254-86913276 TCACATCCAGAGGCCCTGGATGG + Intronic
980773900 4:137414714-137414736 TCTCACACATATGCTCTGGAGGG - Intergenic
981826179 4:148944100-148944122 TAACATCCCTATTCCCTTGAGGG - Intergenic
982748604 4:159132348-159132370 TCACAACCATAGGATCTGGATGG - Intronic
984160189 4:176243233-176243255 TCACATCCACATTCTTTTCATGG - Intronic
984955573 4:185042422-185042444 TCACTACCATATTCTTTGAAGGG - Intergenic
985172775 4:187169979-187170001 TCACATCATCCTTCTCTGGAAGG + Intergenic
985599086 5:816305-816327 TCACAAAGATATTCTCTGGAGGG + Intronic
993288797 5:86038253-86038275 ACAAATCCAAAGTCTCTGGAAGG + Intergenic
996429727 5:123360015-123360037 TCACATCAAAACCCTCTGGAGGG - Intronic
996664019 5:126036711-126036733 TCACATCCATTCTCTTAGGAAGG + Intergenic
997642899 5:135461273-135461295 TCGCATCAAGACTCTCTGGAAGG - Intergenic
999035129 5:148340200-148340222 TTACAAACATATTCTCTGGTAGG - Intergenic
1000495893 5:161984151-161984173 TCTCATACATATTCTCAGCATGG + Intergenic
1000924411 5:167176462-167176484 TCAAATGCATATTATCTAGAGGG + Intergenic
1002049900 5:176564813-176564835 GCCCACCCATAGTCTCTGGATGG + Intronic
1002781836 6:372959-372981 GCACATCCGTCTTTTCTGGACGG - Intergenic
1003419348 6:5941734-5941756 TCACAACCAGATTCTCTTCAAGG + Intergenic
1004331451 6:14725747-14725769 TCACATTAATATCCACTGGAAGG - Intergenic
1004560831 6:16748624-16748646 TCATCTCCATATTCCCTAGAGGG + Intronic
1005922992 6:30417379-30417401 TCTCATCCATATTATCTGCAAGG - Intergenic
1007859820 6:44896911-44896933 TCAGATCCAGATTCTCTTTAGGG + Intronic
1008059799 6:46985117-46985139 TCATTTCCACAATCTCTGGATGG + Intergenic
1008215977 6:48789363-48789385 TTACATCCTTAGGCTCTGGAAGG - Intergenic
1009958685 6:70491026-70491048 CTACATCCATTTCCTCTGGAAGG - Exonic
1011514984 6:88144374-88144396 GTACATGTATATTCTCTGGAAGG - Exonic
1012491831 6:99790346-99790368 TAACATCCAAATTCTCTTGAAGG - Intergenic
1013604003 6:111731433-111731455 TCACAGCCAAATTCTCAGGCTGG - Intronic
1013706432 6:112840447-112840469 TAACTGCCATATTCTCAGGAAGG + Intergenic
1014632005 6:123800002-123800024 TGACATCAATTATCTCTGGATGG + Intergenic
1015147127 6:129999830-129999852 TGACATGCATAATCTCTGTATGG - Intergenic
1015587184 6:134788331-134788353 TTACATCAATATCCCCTGGAGGG - Intergenic
1015934811 6:138398154-138398176 TCACATATATCTTCTCTGTAAGG - Intergenic
1016329445 6:142941639-142941661 GCAAATCCATACACTCTGGATGG + Intronic
1018634520 6:165848897-165848919 TCTCACCCAGAGTCTCTGGAAGG + Intronic
1022325557 7:29327903-29327925 TCTTACCCATTTTCTCTGGAAGG - Intronic
1023487339 7:40701119-40701141 TCACATTTAAAATCTCTGGAGGG - Intronic
1024503953 7:50145319-50145341 TAAGATCCATATTCTTTGCAAGG + Intronic
1025615496 7:63113537-63113559 TCACACCCACCTTCTCTGGCTGG - Intergenic
1028679235 7:93506358-93506380 TCTCATCCATATTCTCCTGCAGG + Intronic
1029137842 7:98387248-98387270 TCACAGCTATAAACTCTGGATGG + Intronic
1030298553 7:107953036-107953058 TTACATCCACATTTTCTGGCAGG - Intronic
1031051209 7:116947866-116947888 TCTCATCCATGTTCACTGGTTGG - Intergenic
1032718080 7:134527996-134528018 GCACACCCTTCTTCTCTGGAGGG + Intronic
1033289654 7:140072485-140072507 TCACATTCATAGGTTCTGGATGG - Intergenic
1033496789 7:141906874-141906896 ACACATGCATTTTCTCTGTAAGG + Intergenic
1038134148 8:24767669-24767691 TCAGATCCATACTCTTTGGGAGG - Intergenic
1038417000 8:27404449-27404471 TCACATTCACATCCTCAGGAGGG + Intronic
1042378966 8:68090724-68090746 TCAGATCCAGATTATCTGAAGGG - Intronic
1044494303 8:92858827-92858849 TTATATCTATATTCTCTTGAGGG + Intergenic
1046271582 8:111904253-111904275 TCACACCCAGAATCTCTGGATGG - Intergenic
1046564083 8:115876335-115876357 TGACATCCCTGTACTCTGGATGG - Intergenic
1048657560 8:136558085-136558107 TCAGATCCATCTCCTCTGGGAGG + Intergenic
1050050865 9:1600083-1600105 TCACATCCATATGCTGAGGCAGG - Intergenic
1050820486 9:9872809-9872831 TCTCCTCCATCTTCTCTTGAAGG - Intronic
1052593187 9:30525317-30525339 TCACATTCATGTTCTCTGCTGGG - Intergenic
1054766035 9:69043338-69043360 ACACATGCATTTTCTCTGTAAGG - Intronic
1055848665 9:80598224-80598246 GCACATGCACATTCTCTGCATGG + Intergenic
1057700967 9:97362783-97362805 CCACATGCATATTTTATGGAAGG + Intronic
1059604802 9:115823213-115823235 TCACTTCTTCATTCTCTGGAAGG + Intergenic
1059856650 9:118405701-118405723 TTTCATCAATATTGTCTGGAGGG - Intergenic
1186133917 X:6498462-6498484 TCACCCTCGTATTCTCTGGAGGG + Intergenic
1186363179 X:8863852-8863874 ACATATCCATTTTCTCTGAAAGG + Intergenic
1186753614 X:12647260-12647282 TCACATCTCTAGTCTCTGGCTGG - Intronic
1187218559 X:17300739-17300761 TGACATTCATAGTCTCTGGTTGG + Intergenic
1188960569 X:36486591-36486613 TCAGATCTGTTTTCTCTGGAAGG - Intergenic
1190766796 X:53481820-53481842 TCACAGCCGTATTCTCTCCAAGG - Intergenic
1195968778 X:110452668-110452690 TGACAGCCACAGTCTCTGGAGGG + Exonic
1198797471 X:140414285-140414307 TCACATCCATATTCAAGGGGAGG + Intergenic